Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA101861 Similarity: 0.977 Similarity: 0.977 Similarity: 0.976
UTR: 5HSAA101861
Gene: SNCA
MFE: -30.679
ENS: 0.973
Length: 121.
Predicted Ligands:
SAM - 20/20 - 20/20


 RS: URS0000C5F3CF_1144311
MFE: -41.819
Ligand: SAM
Species: Brevibacillus sp. CF112 SAM riboswitch (S box leader)
 RS: URS0000DAE9D3_54914
MFE: -42.019
Ligand: SAM
Species: Brevibacillus parabrevis SAM riboswitch (S box leader)
 RS: URS0000D7EE45_1121331
MFE: -28.336
Ligand: SAM
Species: Hathewaya proteolytica DSM 3090 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA101861 URS0000C5F3CF_1144311 URS0000DAE9D3_54914 URS0000D7EE45_1121331
Length 121. 121. 121. 120.
Similarity - 0.977 0.977 0.976
Ensemble Norm 0.973 - - -
MFE -30.679 -41.819 -42.019 -28.336
Ligands - SAM SAM SAM
Gene SNCA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.013 8.013 2.004
Length SE - 0. 0. 1.
Lev Distance - 28. 28. 30.
UBS 7. 8. 8. 7.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 1.
ILR 2. 1. 1. 1.
H 4. 4. 4. 4.
BL 2. 4. 4. 1.
BR 1. 2. 2. 1.
UN 0.306 0.190 0.190 0.242

Sequences

Field Description
UTR seq + 25 ggaggacggcgacgaccagaaggggcccaagagagggggcgagcgaccgagcgccgcgacgcggaagugagugugguguaaaggaauucauuagccATGGATGTATTCATGAAAGGACTTT
UTR dot + 25 …((.((….)).))…….((((……..))))……((..((((((((.(((….)))..))))))))…))………..((((((….))))))……….
RS 1 seq CUCUUAUCCAGAGAAGGCUGAGGGAAUGGCCCUAUGAUGCCCGGCAACCUAGCUGGCAAGAUCACCGUCUUGCGAGCCAAGGUGCUAACUCCAACAGGUAGCGAUACCUGACAGAUAAGAG
RS 1 dot ((((((.((……)).))))))…(((……..))).(((.((((.(((.(((((((….))))))).)))..)))))))……..((((((….))))))………..
RS 2 seq CUCUUAUCCAGAGAAGGCUGAGGGAAUGGCCCUAUGACGCCCGGCAACCUAGCUGGCAAGAUCAAUGUCUUGCGAGCCAAGGUGCUAACUCCAACAGGUAGCGAUACCUGACAGAUAAGAG
RS 2 dot ((((((.((……)).))))))…(((……..))).(((.((((.(((.(((((((….))))))).)))..)))))))……..((((((….))))))………..
RS 3 seq CUCUUAUCAAGAGAGGUGGAGGGACAGGGCCCUAUGAAACCCGGCAACCCGUAUAUGUCACUAACAAUGUCAUAUUCAAUGGUGCCAAUUCCGCAGAUAUUAGUAUUUGCAAGAUAAGAG
RS 3 dot (((((…..)))))….((((……))))………((((..(((((((((.((…….)).)))))…))))))))……(((((((….)))))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table