Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA101875 Similarity: 0.962 Similarity: 0.962 Similarity: 0.961
UTR: 5HSAA101875
Gene: SNCAIP
MFE: -23.097
ENS: 0.992
Length: 129.
Predicted Ligands:
cobalamin - 13/20
FMN - 3/20
TPP - 2/20
 RS: URS0000C3F71B_1229783
MFE: -25.032
Ligand: FMN
Species: Staphylococcus massiliensis S46 FMN riboswitch (RFN element)
 RS: URS0000D97884_1917422
MFE: -28.317
Ligand: FMN
Species: Streptomyces sp. WAC00263 FMN riboswitch (RFN element)
 RS: URS0000ABA31C_12908
MFE: -28.484
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA101875 URS0000C3F71B_1229783 URS0000D97884_1917422 URS0000ABA31C_12908
Length 129. 130. 131. 129.
Similarity - 0.962 0.962 0.961
Ensemble Norm 0.992 - - -
MFE -23.097 -25.032 -28.317 -28.484
Ligands - FMN FMN cobalamin
Gene SNCAIP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.004 28.001 5.017
Length SE - 1. 4. 0.
Lev Distance - 46. 35. 50.
UBS 10. 10. 7. 9.
BS 0. 1. 0. 0.
ILL 6. 4. 5. 5.
ILR 5. 5. 1. 5.
H 2. 2. 1. 1.
BL 1. 1. 1. 2.
BR 0. 2. 1. 1.
UN 0.008 0.069 0.031 0.140

Sequences

Field Description
UTR seq + 25 agcuggggaaaagcaacggcagucgagguaaaaagagcgaaagguaaagaaagagcaggaauuuauaaguauuugaccguacucaaaaugugcaaggaagaauaATGGAAGCCCCTGAATACCTTGATT
UTR dot + 25 .((((..(…..)..))))((((((((((…((.(………………..((..(((((…(((((..((((((…….))))..))..))))))))))..)))))…))))))))))
RS 1 seq GAAUUCUUUCGGGGCAAGGUGAAAUUCCUAACCGGCAGUAAGUUAAGCCUGCGACCUGCAUAAUCUUUAUGUGGCUGAUCUAGUGAGAAUCUAGAGCCGACAGUUAAAGUCUGGAUGGGAGAAAGAAUGA
RS 1 dot ..((((((((…((.((((..((((((…..))…..))))..))))))..((((..((..(((((((((((…(((((…….)))))))).)))..)))))..))..)))).))))))))..
RS 2 seq AAAUUCUUUCGGGGCAGGGUGAAAUUCCCAACCGGCAGUGAUAUGAGCCUGCGACCUGCUAACAAUUGUUAGUGGCUGAUCUAGUGAAAUUCUAGAGCCGACAGUUAAAGUCUGGAUGGGAGAAAGAAUAA
RS 2 dot ..((((((((……………(((((.((((………………….(((…(((((((…(((…(((((…….)))))))))))))))..))))))).)))))))))))))..
RS 3 seq AUACUGAAUCGUGUUGGGGAAUCAAGGUGAAAUUCCAUGGCUCUACCAGGAACCGUAAAGUCGGAGUGCCAACCAGUAUAGUCCGCUGUCGAACGAGGGCCUGGGAAAGUCUAGUUCUGCAAUUUAAAA
RS 3 dot …………((((.(((((……((..((((..((((((………(((..((.((((((((……))))..))))))…..)))))))))..))))..))..))))).))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table