Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA101880 Similarity: 0.950 Similarity: 0.949 Similarity: 0.949
UTR: 5HSAA101880
Gene: SNCAIP_0
MFE: -33.815
ENS: 0.842
Length: 163.
Predicted Ligands:
cobalamin - 5/20
Mg2+ - 5/20
FMN - 3/20
 RS: URS0000C15B83_1345695
MFE: -32.325
Ligand: molybdenum
Species: Clostridium saccharobutylicum DSM 13864 Moco (molybdenum cofactor) riboswitch
 RS: URS0000C3296C_1502724
MFE: -65.804
Ligand: cobalamin
Species: Devosia sp. LC5 Cobalamin riboswitch
 RS: URS0000C868D7_1391729
MFE: -87.412
Ligand: Mn2+
Species: Brevundimonas abyssalis TAR-001 yybP-ykoY manganese riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA101880 URS0000C15B83_1345695 URS0000C3296C_1502724 URS0000C868D7_1391729
Length 163. 161. 162. 162.
Similarity - 0.950 0.949 0.949
Ensemble Norm 0.842 - - -
MFE -33.815 -32.325 -65.804 -87.412
Ligands - molybdenum cobalamin Mn2+
Gene SNCAIP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10. 2.004 13.004
Length SE - 4. 1. 1.
Lev Distance - 57. 67. 62.
UBS 12. 11. 12. 11.
BS 0. 0. 0. 0.
ILL 6. 7. 6. 3.
ILR 5. 5. 5. 4.
H 4. 2. 3. 4.
BL 1. 1. 1. 2.
BR 0. 2. 1. 1.
UN 0.117 0.112 0.056 0.056

Sequences

Field Description
UTR seq + 25 aaagugggaagcgcggacaaaaaguaggcggggaggagaggagagccccagcuggggaaaagcaacggcagucgagguaaaaagagcgaaaggaauuuauaaguauuugaccguacucaaaaugugcaaggaagaauaATGGAAGCCCCTGAATACCTTGATT
UTR dot + 25 …(((…..)))……………((((…………)))).((((..(…..)..))))((((((((((…((.(…..((..(((((…(((((..((((((…….))))..))..))))))))))..)))))…))))))))))
RS 1 seq AAAUUAAAUAAUCUCCGUGCAAAAAUAUCUAAGGAAUAAGGCAUAUGCUUAAAUCUAUGAUAUUGCGCCAAAGUGAAAAAUUAUAUGAUUAAUCACUUUCAGGGUUACUUGGGAAACCAUUUGACCUUCCGUAUUUGAAAAGGAGAGUUAUUUACUUAGGC
RS 1 dot ………………(((…(((((…(((…((((….))))…)))..))))))))(((.((((((……..((((((..((..(((((((((((..(((….)))..))))))……..)))))..)).)))))))))))).)))
RS 2 seq GCAAGCGAAAGGCUGGAAAAGGGAACACGGUGCGACGUACCCAUCAGGGCGCAAAACCGUGGCUGCCCCCGCAACUGUAAGCGGUGCAUUCCCCUCUCAUGCCACUGGCGAAUAGCCGGGAAGGCGAGGGGAGUGGCUAUCACCGCGAGCCAGGAGACCUGC
RS 2 dot ….(((…(((……..((..(((((((((…..(((….))))))…)))))).)))))..)))….((..((((((((((((((((….(((.(((((…..)))))…)))))))))))))…..))))))..))((((…)))).
RS 3 seq UUGGGGAGUAGCCGCCGGCCGCCUUGAAGGCCGGGACCACGUCAACAUAUUCGCGCUUCGGCGCGUGGCGCGGUCAGCGGAGGUCAUCCGCCUGGCGAGACCAGCGCGUCCCACCGUCUCGCCGGCGGCGUGGGAUGCGCGUCUCGUCGUCCGGCGGAGUGA
RS 3 dot …((……)).((((((……..))))))((((.(((..((…..((((((.((…)).))))))))..)))..)))).(((((((((((((((..(((((((((((((((…..)))))..)))))))))))))))))))…))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table