Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA101881 Similarity: 0.970 Similarity: 0.965 Similarity: 0.963
UTR: 5HSAA101881
Gene: SNCAIP_1
MFE: -32.204
ENS: 0.994
Length: 150.
Predicted Ligands:
FMN - 17/20
cobalamin - 3/20

 RS: URS0000C4CA9D_284581
MFE: -40.486
Ligand: FMN
Species: Bacillus koreensis FMN riboswitch (RFN element)
 RS: URS0000C21DAF_1473
MFE: -41.398
Ligand: FMN
Species: Virgibacillus pantothenticus FMN riboswitch (RFN element)
 RS: URS0000DAA6CF_411959
MFE: -42.698
Ligand: FMN
Species: Virgibacillus chiguensis FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA101881 URS0000C4CA9D_284581 URS0000C21DAF_1473 URS0000DAA6CF_411959
Length 150. 149. 149. 149.
Similarity - 0.970 0.965 0.963
Ensemble Norm 0.994 - - -
MFE -32.204 -40.486 -41.398 -42.698
Ligands - FMN FMN FMN
Gene SNCAIP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.004 3.003 13.003
Length SE - 1. 1. 1.
Lev Distance - 37. 44. 42.
UBS 10. 11. 10. 11.
BS 1. 1. 1. 1.
ILL 3. 5. 4. 4.
ILR 4. 4. 3. 3.
H 3. 3. 3. 3.
BL 3. 3. 2. 2.
BR 2. 2. 2. 5.
UN 0.127 0.067 0.074 0.074

Sequences

Field Description
UTR seq + 25 agucgagguaaaaagagcgaaagguaaagaaagagcagguucguggacaggagccggcgggcaggccgggggaucccuggaauuuauaaguauuugaccguacucaaaaugugcaaggaagaauaATGGAAGCCCCTGAATACCTTGATT
UTR dot + 25 .(((((((((……((…..))………((..((((((.(……..).))))))..))((((((.(((.(…………(((((..((((((…….))))..))..)))))).)))..))))))..))))))))).
RS 1 seq AUCUAUCUUCGGGGCAGGGUGAAAUUCCCGACCGGCGGUAAUAAGCGCGAUGACGCUUUGAGCCCGCGAGCCGUACCUCGCUAAAAGGUAUAGCAGGAUUUGGUGAGAUUCCAAAGCCGACAGUACAGUCUGGAUGGGAGAAGGUGGAG
RS 1 dot .(((((((((..((..(((…….)))..)).((((….(((((……)))))…..))))…((((.((..(((…..((((.(..((.(((((…….))))).))..).)))))))..))))))..))))))))).
RS 2 seq UGAUUCCUUCGGGGCAGGGUGAAAUUCCCGACCGACGGUAAAAAGUGGUACAACACUUUAAGUCCGUGACCCGUUUGAUAUUUAUGCAAACGGUGGAUCUGGUGCGAAUCCAGAACCGACAGUUAAAGUCUGGAUGGGAGAAGGAAAAC
RS 2 dot …(((((((..((..(((…….)))..)).((((…((((((……))))))….))))..((((((((((.((((.((…((((…(((((…….)))))))))…))))))))).))))))).)))))))…
RS 3 seq GCAUUCCUUCGGGGCAGGGUGAAAUUCCCGACCGACGGUGAAAAGUGGUACGCCACUUUAAGUCCGUGACCCGUUUGAUAUUCGCGCAAACGGUGGAUCUGGUGUGAUUCCAGAACCGACAGUUAAAGUCUGGAUGGGAGAAGGAAAAA
RS 3 dot …(((((((..((..(((…….)))..)).(((((..(((((((….)))))))..).))))..((((((((((.((.((…..((((…(((((…….)))))))))…)).)).))).))))))).)))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table