Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA101886 Similarity: 0.965 Similarity: 0.964 Similarity: 0.963
UTR: 5HSAA101886
Gene: SNCAIP_2
MFE: -28.369
ENS: 0.910
Length: 138.
Predicted Ligands:
FMN - 6/20
TPP - 4/20
glycine - 2/20
 RS: URS0000C63C23_1286631
MFE: -52.903
Ligand: glycine
Species: Sphaerotilus natans subsp. natans DSM 6575 Glycine riboswitch
 RS: URS0000C6BFA8_1736410
MFE: -46.310
Ligand: FMN
Species: Arthrobacter sp. Soil782 FMN riboswitch (RFN element)
 RS: URS0000D961F6_1519565
MFE: -28.669
Ligand: TPP
Species: Fistulifera solaris TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA101886 URS0000C63C23_1286631 URS0000C6BFA8_1736410 URS0000D961F6_1519565
Length 138. 137. 137. 139.
Similarity - 0.965 0.964 0.963
Ensemble Norm 0.910 - - -
MFE -28.369 -52.903 -46.310 -28.669
Ligands - glycine FMN TPP
Gene SNCAIP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 5.003 2.003
Length SE - 1. 1. 1.
Lev Distance - 44. 45. 47.
UBS 12. 11. 11. 12.
BS 0. 0. 1. 0.
ILL 3. 2. 3. 3.
ILR 3. 4. 3. 4.
H 4. 4. 3. 4.
BL 3. 3. 4. 3.
BR 3. 3. 4. 2.
UN 0.101 0.073 0.044 0.043

Sequences

Field Description
UTR seq + 25 aguuugaucucagacugcugugcuagcaaucagcgagacuccgugggcguaggacccuccgagccaggaauuuauaaguauuugaccguacucaaaaugugcaaggaagaauaATGGAAGCCCCTGAATACCTTGATT
UTR dot + 25 ((((((….))))))((((……….))))..(.(((.(.((((….).))).).))))((((..(((((…(((((..((((((…….))))..))..))))))))))….))))…………
RS 1 seq CGACACCUCACUGGAGAGAGGCCGUGGGCGUCACCCUCAAGCGACGCGACGCGGUCCACCGAAGGGGCAAGCGCUGCGCGAUCCAACCGGAUCCGCUCGGCGUCAAUCUCUCAGGUAAAGCGGACAGCGAGGGCAGC
RS 1 dot …..((((……..))))(((((.(((((.(……).)))))..)))))((((((..(((((…((((((.(((((((….))))).)).))))))…)))))..)))…..)))..((….))…
RS 2 seq AACGUGCUCCGGGGUCGGUGUAAUUCCGAACCGGCGGUUAUAGUCCGCGACCCGCGCGCAGCCCCCUGGGGCAGCAAACGGUUGAGCCGGUGAAAUUCCGGCACCGACAGUUAAAGUCUGGAUGGGAGAAGCACGUG
RS 2 dot .(((((((((((..((((…….)))).)))).((((…((.((((…)))).))))))((((.((((….(((.((((.(((((…….)))))..)))).)))…)))).)..)))…))))))).
RS 3 seq CACUCUCGCUGCGGGAGCUUGAUGUGGGAAAUAAUAUGCUGAGAGUUUCAAAGUCUAUGGUUCUUGAAAAGACUUUGUAUCGACCGUUCGAACCUGCUCAUGGUAAUGCAUGCGAAAGGGAACGUGAGUUGUGCAAUGG
RS 3 dot (((((..(((…..)))..)).))).(((((..(……)..)))))(((((((………….)))))))(((.(((((((((…(((.(.((((……)))).)..))))))))…)))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table