Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA102023 Similarity: 0.972 Similarity: 0.971 Similarity: 0.971
UTR: 5HSAA102023
Gene: SNRPG
MFE: -35.188
ENS: 0.894
Length: 113.
Predicted Ligands:
TPP - 5/20
methionine - 4/20
guanidine - 4/20
 RS: URS0000C35703_1666914
MFE: -39.805
Ligand: TPP
Species: Rhodobacteraceae bacterium HLUCCO07 TPP riboswitch (THI element)
 RS: URS0000C3E0EF_1220594
MFE: -38.290
Ligand: TPP
Species: Parageobacillus caldoxylosilyticus NBRC 107762 TPP riboswitch (THI element)
 RS: URS0000AB697F_351607
MFE: -51.664
Ligand: TPP
Species: Acidothermus cellulolyticus 11B TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA102023 URS0000C35703_1666914 URS0000C3E0EF_1220594 URS0000AB697F_351607
Length 113. 113. 113. 113.
Similarity - 0.972 0.971 0.971
Ensemble Norm 0.894 - - -
MFE -35.188 -39.805 -38.290 -51.664
Ligands - TPP TPP TPP
Gene SNRPG - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.002 11.002 6.
Length SE - 0. 0. 0.
Lev Distance - 37. 34. 37.
UBS 10. 10. 9. 10.
BS 0. 0. 0. 0.
ILL 2. 2. 4. 2.
ILR 2. 3. 4. 2.
H 3. 4. 2. 2.
BL 3. 3. 2. 4.
BR 2. 3. 2. 4.
UN 0.071 0.027 0.027 0.088

Sequences

Field Description
UTR seq + 25 agacgcaagacgccgggccuacagcgggagcgugaggaaagccgugcguugcguuccaaggcaucugugagcccgcggaguauacaccATGAGCAAAGCTCACCCTCCCGAGT
UTR dot + 25 .((((((..(((((((.(((.((((….)).)))))….))).))))))))))….(((……..)))((.((((………(((((…)))))..))))))…
RS 1 seq UGUGUUACCUCGGGGUGCCUGGACGGCGGUUCAGGCUGAGAUGCUGAGCAAGAGGCGAACCCGUUGAACCUGAACCGGUUAAGACCGGCGGAGGGAAGGUCUGGGAGACUCCC
RS 1 dot .((.((..(((((.((((((((((….))))))))….)).)))))…)).)).((((.(((…….))).)))).(((((..(…..)..)))))((((…))))
RS 2 seq GAUAUAGCAUGCGGGAGCUUGCGGAAGCAGGCUGAGAGUACGGCUAUAUUCCGCCGUUGACCGUUUGAACCUGUUUGGGUAAUGCCAGCGCAGGGAAAGUGAGGAUGGGGCCG
RS 2 dot ((((((((.(((…(((((((….)))))))….)))..))))))))((.(((((..(..(((…(((((((((……)))).))))).)))..)..)))))))…
RS 3 seq UGGGGUCGGCGCGGGAGCCCGGGGCACCGGGCUGAGAGGGCAGCUGACGCCGCUGCCGACCGUGGAACCUGCUCCGGGUCAUGCCGGCGAAGGGAGGCUGCGUGGGUCACCGU
RS 3 dot .((.((((((((…(((((((….)))))))……)).)))))).))…(((.(.(((((..(((.((((((……))))….)).))))))))).)))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table