Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA102124 Similarity: 0.946 Similarity: 0.946 Similarity: 0.944
UTR: 5HSAA102124
Gene: SNX13
MFE: -77.853
ENS: 0.749
Length: 193.
Predicted Ligands:
cobalamin - 19/20
FMN - 1/20

 RS: URS000231D194_1592629
MFE: -79.573
Ligand: cobalamin
Species: Sphingomonas sp. WG Cobalamin riboswitch
 RS: URS000232195D_1896196
MFE: -73.201
Ligand: cobalamin
Species: Porphyrobacter sp. LM 6 Cobalamin riboswitch
 RS: URS000232187F_1121390
MFE: -67.621
Ligand: cobalamin
Species: Desulfacinum hydrothermale DSM 13146 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA102124 URS000231D194_1592629 URS000232195D_1896196 URS000232187F_1121390
Length 193. 193. 192. 192.
Similarity - 0.946 0.946 0.944
Ensemble Norm 0.749 - - -
MFE -77.853 -79.573 -73.201 -67.621
Ligands - cobalamin cobalamin cobalamin
Gene SNX13 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8. 15. 3.
Length SE - 0. 1. 1.
Lev Distance - 68. 63. 73.
UBS 17. 17. 16. 16.
BS 0. 0. 0. 0.
ILL 5. 6. 6. 5.
ILR 7. 6. 7. 7.
H 3. 2. 3. 3.
BL 6. 7. 3. 5.
BR 3. 5. 5. 4.
UN 0.047 0.036 0.052 0.068

Sequences

Field Description
UTR seq + 25 agacgcggacgucgcucuuccaagauggcggcgcguccgucgcgagcgaccgggccgaggggaggccagcgaagccgaguaaaaccgccgcccgggagaagacugaaggagcaguugccgccguuggcggcggcccgagcaguuuucgcugcugcuacggcuguaauaATGTTAACTGAGGCCAGTCTATCCA
UTR dot + 25 ….(((((((.((((…(((…))).))))))))))).(((.(((((..(((((..((….))..))..)))..))…..))))))…(((..((((((.((.(((((((((.((((.((((((((((..(((…..))))))))))))))))).)))))..))))..))…..)))))).))).
RS 1 seq ACCUCCACCAACCGUAUCGGUGCCCAACGGGCUUGAUAGGGAAUGCGGUGCGGGCGUGCCCAAUGCCGCAGCUGCCCCUGCAACUGUAAGCGGCGAGCGAUCGGCCCGGUUGCCAUUGGAAGCGAUUCCGAGAAGGUGGGCCGAUCCGCGAUGACCCGCAAGCCAGGAGACCUGCCGAUAUGGGUCGCUCGUC
RS 1 dot …..((((..((.((((((.(((…..))))))))).))…..))))((((((.(((((…..((((…(.((((…..((..((((((.((((((((((((.((..(.((((((….))))))).)).)))))))))).))..))..))))..)))))).)..))))…..)))))))))))..
RS 2 seq AGCGUUUCCCCGCGUUUCGGUAACGGGAAUGCGGUUCGAUUCCGCAGCUGUCCCUGCAACUGUAAGCGGUGAGUGUGGAGUGCGCUCCCUUUUCGAAGGGCAGCCACUGGGGGUCUUCGGGCCACCCGGGAAGGUGAGCAUCCCAUGCGUUGACCCGCGAGCCAGGAGACCGACCGGGGCGUGUCGCUCUUU
RS 2 dot .(((((((((((…..)))….))))))))((..(((((((((((((((…(((….))).)))))…)))))))).))..))……((..(((((((.((((.(((((((.(((….((((..((…((((…)))).))..))))…))).)))))))..))))))).))))..))…
RS 3 seq AAUUGAAUCGAGCGGUCAGGUGCCCGGCCGUGGGCUUAAGAGGGAAUCCCGUGCGAAUCGGGAGCGGUCCCGCCGCUGUGAACGGGGACGAAAUCCGCGCAAAAGCCACUGCUUCUCUUUUUGAGAAGCGGGAAGGUGCGGAGAGUAGGGCGAUCCGUGAGCCAGAAGACCUGCCUGACCGAAGGGAAGCGG
RS 3 dot ………..((((((.((…)))))))).(((((..(.((((.(((((((((…(((((….))))).)))…..))))))……))).).)..))))).((((((((((((.(.((..(((((..((((((((..((…))..)))))..)))……))))))).)..))))))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table