Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA102157 Similarity: 0.967 Similarity: 0.967 Similarity: 0.966
UTR: 5HSAA102157
Gene: SNX14
MFE: -32.854
ENS: 0.808
Length: 131.
Predicted Ligands:
FMN - 9/20
cobalamin - 3/20
SAM - 3/20
 RS: URS0000DB36F1_1817896
MFE: -21.699
Ligand: glucosamine
Species: candidate division WS6 bacterium RIFOXYB1_FULL_33_14 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000AB24BF_12908
MFE: -30.150
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000DA9E8C_1802069
MFE: -41.030
Ligand: glucosamine
Species: Candidatus Roizmanbacteria bacterium RIFCSPLOWO2_01_FULL_44_13 glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA102157 URS0000DB36F1_1817896 URS0000AB24BF_12908 URS0000DA9E8C_1802069
Length 131. 129. 131. 131.
Similarity - 0.967 0.967 0.966
Ensemble Norm 0.808 - - -
MFE -32.854 -21.699 -30.150 -41.030
Ligands - glucosamine cobalamin glucosamine
Gene SNX14 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14.001 4.004 16.001
Length SE - 4. 0. 0.
Lev Distance - 33. 43. 38.
UBS 10. 8. 10. 8.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 2.
ILR 1. 0. 2. 0.
H 4. 4. 4. 4.
BL 5. 2. 4. 2.
BR 2. 2. 3. 1.
UN 0.229 0.256 0.168 0.191

Sequences

Field Description
UTR seq + 25 gggaaaaggggucgaggccgguccugaccuguuacaaugaagacugacuugcuaugugggauuacaccagaagcuugcaguggaguaaugguauauucauauuuuaATGATCTTCTGGTCATTTGTTGCTG
UTR dot + 25 …..((.(((((.(((…..)))))))).))………((((.(..(((.(.(((…….))).))))..))))).(((((……)))))…….(((((((….)))))))……..
RS 1 seq AUAUAUAUAUUAGCGGCUGGGUCUAAUAGACUACGAGGAGAAGGUUAUCGAGUUAUCAGCGGAUGCCUUCAGGUUCAUGUAUAAACCUAAAUGAGAUUACAAAUACACAGAGUAUCUCUAAAUACAUUU
RS 1 dot …….(((((((……).))))))………..(((((.((((..(((…))).)))))))))(((((……..)))))….((((.(((………..)))))))………..
RS 2 seq AUACUGAAAUGCAUGGUGGGAAAUCAGUGUGAAAUUCAUUGGCUGUUCCUGCAACCGUAAAGUCGGAGCGCCACCCGGUAUAGACCCCUGUCGAAUGAUGGCCAGGAAAAGCCUAGUUCUGCAAAAUAGCA
RS 2 dot (((((((..(.(……).)..)))))))………((((.(((((.((………)).)))))))))…(((….)))..(((.((((…(((……..)))..)))).)))……..
RS 3 seq UAUUUAACAUUAGCGUGUGGCCUCGCCUCUGGCGGGGAUACGAGGAGAGGGAAAAUCGAAUAAUCUGCGGAUCCCCUCAAGCCGUGAUUGCCGGCUUUAAAAUUUUGUUGAAAAACAAAAUUUGUAAUUAC
RS 3 dot ………….(((((..(((((((…))))))))))))..(((.((((…(((………))).)))))))((((((.(….)))))))..((((((((((….))))))))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table