Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA102206 Similarity: 0.989 Similarity: 0.987 Similarity: 0.986
UTR: 5HSAA102206
Gene: SNX2
MFE: -26.305
ENS: 0.959
Length: 74.
Predicted Ligands:
fluoride - 13/20
cobalamin - 4/20
2'-dG-II - 2/20
 RS: URS0000C566F9_1804984
MFE: -22.842
Ligand: fluoride
Species: Burkholderia sp. OLGA172 Fluoride riboswitch
 RS: URS0000C00C18_670052
MFE: -19.203
Ligand: fluoride
Species: Cryobacterium sp. SK1 Fluoride riboswitch
 RS: URS0000C3FADD_12908
MFE: -20.601
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA102206 URS0000C566F9_1804984 URS0000C00C18_670052 URS0000C3FADD_12908
Length 74. 72. 73. 74.
Similarity - 0.989 0.987 0.986
Ensemble Norm 0.959 - - -
MFE -26.305 -22.842 -19.203 -20.601
Ligands - fluoride fluoride glutamine
Gene SNX2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.002 2. 1.003
Length SE - 4. 1. 0.
Lev Distance - 10. 16. 18.
UBS 5. 5. 5. 5.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 1. 1.
H 2. 2. 2. 2.
BL 3. 2. 3. 3.
BR 2. 2. 1. 2.
UN 0.230 0.278 0.233 0.284

Sequences

Field Description
UTR seq + 25 gugacggguccgcgaggcccagcucgcgcagucguucgggugagcgaagATGTCTGCTCCCGTGATCTTTGATA
UTR dot + 25 ..(((((.(.((((((……)))))).).)))))..((.(((((……..)))))))………….
RS 1 seq UUGCGCGCUGGGGAUGGCAUUCUCCACAUGCUCCAUUCGCCGCCCUUGAUGGCUGGUGAUGCCUGCUUCGCC
RS 1 dot ..(((.(.((((((……))))))).)))…..((((((((……))).)))))………….
RS 2 seq CUUUUGCGUGGUGAUGGAUCCCACCAGAGCACCCGCUCGAACCGCCGAUUGCGCUGAUGGUUCCUACCGACUU
RS 2 dot …..(((.((((.(((……)))…)))))))..((((((.((…….)).))))))……….
RS 3 seq AUCGUUGGGCUCGGGCCUGCUCUUACAGACCUCUUCAGCCGGAAGUAGCCACCCGCGUGGCGAAGCAACGCUCC
RS 3 dot ….((.((((.(((.(((……))).)))….)))).))….(((((….)))))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table