Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA102221 Similarity: 0.955 Similarity: 0.954 Similarity: 0.954
UTR: 5HSAA102221
Gene: SNX24
MFE: -36.151
ENS: 0.931
Length: 155.
Predicted Ligands:
cobalamin - 7/20
FMN - 7/20
Mg2+ - 3/20
 RS: URS000233295D_1797200
MFE: -70.675
Ligand: cobalamin
Species: Actinobacteria bacterium RBG_16_64_13 Cobalamin riboswitch
 RS: URS0000DAC507_914237
MFE: -41.494
Ligand: TPP
Species: Rhynchosporium commune TPP riboswitch (THI element)
 RS: URS0000DB66D1_1229727
MFE: -64.158
Ligand: cobalamin
Species: Thiobacimonas profunda Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA102221 URS000233295D_1797200 URS0000DAC507_914237 URS0000DB66D1_1229727
Length 155. 155. 156. 154.
Similarity - 0.955 0.954 0.954
Ensemble Norm 0.931 - - -
MFE -36.151 -70.675 -41.494 -64.158
Ligands - cobalamin TPP cobalamin
Gene SNX24 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.006 13. 11.006
Length SE - 0. 1. 1.
Lev Distance - 59. 54. 55.
UBS 11. 11. 11. 12.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 4.
ILR 3. 2. 4. 3.
H 4. 5. 5. 5.
BL 2. 3. 3. 3.
BR 4. 4. 1. 2.
UN 0.058 0.135 0.077 0.136

Sequences

Field Description
UTR seq + 25 cccguccuuucgcuaugaagagagcgaccuggagcggggauacacgaagugaucacuuuguaacguaugagcuucugaaagagagagaccauucaacuugaaauauaagguguuuaagauagaagugcuaATGGAGGTCTACATCCCGTCCTTTC
UTR dot + 25 (((((((..(((((……..)))))…))).)))).(((((((((((….)))))))…))))(.(((((((……(((.(((………………))).)))….))))))).)….(((((……..)).)))….
RS 1 seq CAAGAAUGGUGCCUCCGCAGUAAGGCUCCGGGUAAGACCGGAGCCGAAAGGGAAGCCGGUGAGAAGCCGGCACGGUCCCGCCACUGUAACCGGGUUUCGCGAGAAGGAGCGCGAAGACCCGGGAGUCAGACACCUGCUGUAGAGGAGGAGCAGAC
RS 1 dot ……((.(((….))).)).((((((((……))))))))….((((.((((((…..))))))….))))….((((..((((((((((((……..))))).)))))))..).)))….(((((.(……).)))))..
RS 2 seq CGGCUUCACUACGGGCGCCUAGUCGAAAUAGUUACUUGUGAUCGAACUCUUUCUUUUUAGAAGGAGAGACGACAAGUCCGUUGAGACGAAGCUGAGAUUGUACCGUGAACACUCGAUCAAGUUAGGACUUGCGUGGGAAAGUGACUGCCGCUUUGA
RS 2 dot .(((.((……)).)))…((((.((((….))))..)))).((((((((….))))))))..(((.((((((((((((((((..((…….))..)))…..))))))…….))))))))))…((((((…..))))))..
RS 3 seq GAGGGUGCGCCGCCAUGCGCGGCCGCAGGGAACCGGGUGAAAGGCCCGGACUGCCCCCGCAACUGUAAGCGAAGAGCGCCGAGGAUCAUCCCACUGGCAACCCUGCCGGGAAGGGCCGAGGCGCGGUGAGACGCGAGUCAGGAGACCUGCCCUU
RS 3 dot ….(((.(((((…..)))))))).(((..((((((…..))))))…..)))(((……..)))….(((((..((..(.((((…((((….)))))))).)..))..)))))……..(((.(((….))).)))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table