Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA102514 Similarity: 0.974 Similarity: 0.971 Similarity: 0.970
UTR: 5HSAA102514
Gene: SORD
MFE: -31.242
ENS: 0.839
Length: 123.
Predicted Ligands:
TPP - 12/20
guanidine - 4/20
molybdenum - 3/20
 RS: URS0000C246BC_1081109
MFE: -43.067
Ligand: TPP
Species: Aschersonia aleyrodis RCEF 2490 TPP riboswitch (THI element)
 RS: URS0000C42C90_112090
MFE: -35.805
Ligand: TPP
Species: Aphanomyces astaci TPP riboswitch (THI element)
 RS: URS0000C076BD_157072
MFE: -39.486
Ligand: TPP
Species: Aphanomyces invadans TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA102514 URS0000C246BC_1081109 URS0000C42C90_112090 URS0000C076BD_157072
Length 123. 122. 124. 125.
Similarity - 0.974 0.971 0.970
Ensemble Norm 0.839 - - -
MFE -31.242 -43.067 -35.805 -39.486
Ligands - TPP TPP TPP
Gene SORD - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.003 11.002 7.
Length SE - 1. 1. 4.
Lev Distance - 30. 34. 33.
UBS 7. 7. 8. 7.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 1.
ILR 4. 1. 2. 2.
H 2. 3. 3. 3.
BL 2. 2. 1. 1.
BR 1. 2. 3. 2.
UN 0.260 0.205 0.218 0.264

Sequences

Field Description
UTR seq + 25 agaacccaccaauuccggacacaaagagaggaguauauaugugauuaagauauguauuucugacuugaagugaaauauucuggaaaacucacacaacuATGGCGGCGGCGGCCAAGCCCAACA
UTR dot + 25 …………((((((((((.(((..((((((((((((.(…..).))))))))))))..)))…)))……)))))))……………((((((….)))..)))…..
RS 1 seq AGAAUUGCAGCCGGGUGUUCAAUCCCCCUCCACACGUGCGGUGAGGGGGGGGAUUGAUCUGAGAAAUACCGGUGAACUUGAUCUGGAUAAUGCCAGCGAAAGGAUCUGCUUCUUGAAGACCC
RS 1 dot ………(((.((((((((((((((((((.(((…..))).)))))))))))))……..))))))))………((((……))))((((((……))).)))…….
RS 2 seq UGAACCAGCGAGGGGUGCCAUUGGAGUAUACCCGACCCAUGGGUGUCAUUCCUUCGGCUGAGAUUAUACCCUAAAUAACCUGAUCCGGGUCAUACCGGCGGAGGGACUGCUGUGCUCGAUUGAU
RS 2 dot ………..((((((((…((((((((((((…..))))))).)))))…)))………)))))…..(((((…)))))…..(((((.((……)).))).))……
RS 3 seq GAAACCAGCGAGGGGUGCCAUUGGAGUAUACCCUUGUCCAUGGGUAUCAUUCCUUUGGCUGAGAUCAUACCCUAAAUUACCUGAUCCGGGUUAUACCGGCGGAGGGACUGCUGCGUUGUUGCUAC
RS 3 dot ………..(((((((((..(((((((((((……..)))))).)))))..))))………)))))…………((((……))))((.((……)).))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table