Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA102702 Similarity: 0.975 Similarity: 0.974 Similarity: 0.973
UTR: 5HSAA102702
Gene: SP8
MFE: -23.276
ENS: 0.808
Length: 116.
Predicted Ligands:
FMN - 6/20
TPP - 4/20
glycine - 3/20
 RS: URS0000AB44EB_190304
MFE: -24.057
Ligand: FMN
Species: Fusobacterium nucleatum subsp. nucleatum ATCC 25586 FMN riboswitch (RFN element)
 RS: URS0000AB3313_879305
MFE: -24.363
Ligand: FMN
Species: Anaerococcus prevotii ACS-065-V-Col13 FMN riboswitch (RFN element)
 RS: URS0000C867DB_571913
MFE: -54.885
Ligand: methionine
Species: Luteipulveratus mongoliensis S-adenosyl methionine (SAM) riboswitch,
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA102702 URS0000AB44EB_190304 URS0000AB3313_879305 URS0000C867DB_571913
Length 116. 116. 117. 116.
Similarity - 0.975 0.974 0.973
Ensemble Norm 0.808 - - -
MFE -23.276 -24.057 -24.363 -54.885
Ligands - FMN FMN methionine
Gene SP8 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.017 8.006 21.009
Length SE - 0. 1. 0.
Lev Distance - 31. 31. 29.
UBS 6. 7. 6. 9.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 4.
ILR 2. 3. 2. 1.
H 1. 3. 3. 1.
BL 2. 1. 0. 3.
BR 0. 1. 0. 3.
UN 0.164 0.293 0.239 0.069

Sequences

Field Description
UTR seq + 25 aucauuguauugcacaccucuaaaaaaaacacugccucugauuuaucaauauaaaaaagauccucugagaggaggagggcacuuuugugugATGGCAACTTCACTTCTAGGGGAAG
UTR dot + 25 …………….((((((……….((((……..(((.((((((((..(.((((((…….)))))))..)))))))))))))))……….))))))…
RS 1 seq AAUAAUCUUCGGGGCAGGGUGAAAUUCCCGACCGGUGGUAUAGUCCACGAAAGUAUUUGCUUUGAUUUGGUGAAAUUCCAAAACCGACAGUAGAGUCUGGAUGAGAGAAGAAAAGA
RS 1 dot …………((..(((…….)))..)).((((……))))…((..(((((((((.(((((…….)))))..))).))))))..))………………
RS 2 seq GAUUAUCUUCAGGGAAAGGUGAAAUUCCUUAACCGGCAGUAGAGUCUGCGAGUCCUACGGGAUUGAAUUGGUGUGAUUCCAAUACCGACAGUAUAGUCUGGAUGAAAGAAGAUUUAU
RS 2 dot ………..((..((((…….))))..)).((((……))))..((((….((((((..(((((((…….)))))))…..))))))))))…………..
RS 3 seq GGUCAAGAGUCUCAGCGUCAAGCCCCGGCUUGCUGAGCGGCAACCCUCCGCCGCGGUGGGGUGCUCCGGGUGACGACCCGGCCCACCCGGCAGCCGCCCGUGGGCAAGCGCGAGUC
RS 3 dot ……..(.(((.((((…(((((((……..(((((……..((((.((((((…..((((((….)))))))))))))))).)))))))).))))..))))))).)

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table