Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA102704 Similarity: 0.975 Similarity: 0.974 Similarity: 0.974
UTR: 5HSAA102704
Gene: SP8_0
MFE: -23.276
ENS: 0.805
Length: 113.
Predicted Ligands:
TPP - 6/20
FMN - 6/20
glycine - 3/20
 RS: URS0000C6FFE7_1635290
MFE: -29.383
Ligand: TPP
Species: Parcubacteria bacterium 33_209 TPP riboswitch (THI element)
 RS: URS0000C3AD6B_1263017
MFE: -19.214
Ligand: FMN
Species: Firmicutes bacterium CAG:313 FMN riboswitch (RFN element)
 RS: URS0000C5A132_1401063
MFE: -42.652
Ligand: SAM
Species: Pseudoglutamicibacter albus DNF00011 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA102704 URS0000C6FFE7_1635290 URS0000C3AD6B_1263017 URS0000C5A132_1401063
Length 113. 113. 113. 114.
Similarity - 0.975 0.974 0.974
Ensemble Norm 0.805 - - -
MFE -23.276 -29.383 -19.214 -42.652
Ligands - TPP FMN SAM
Gene SP8 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.006 9.013 15.
Length SE - 0. 0. 1.
Lev Distance - 32. 32. 29.
UBS 6. 7. 6. 8.
BS 0. 0. 0. 0.
ILL 3. 3. 2. 1.
ILR 2. 1. 2. 3.
H 1. 2. 3. 3.
BL 2. 1. 0. 3.
BR 0. 1. 0. 1.
UN 0.142 0.221 0.257 0.132

Sequences

Field Description
UTR seq + 25 auuguauugcacaccucuaaaaaaaacacugccucugauuuaucaauauaaaaaagauccucugagaggaggagggcacuuuugugugATGGCAACTTCACTTCTAGGGGAAG
UTR dot + 25 ………….((((((……….((((……..(((.((((((((..(.((((((…….)))))))..)))))))))))))))……….))))))…
RS 1 seq UAUUAUUUAUGGGGGAGCCUGUAUGUAAUCAGGCUGAGAAAAGAAUGGCAUUUCUUGACCCUUAGAACCUGAACUGGUUAAUACCAGCGGAGGGAAAUGUAAAUGCUAUCGAA
RS 1 dot ……………((((((……..))))))…….(.((((((((((….((((……(((..(((((….))))))))))))….).))))))))))…
RS 2 seq AAGUAUCUUCAGGGCAGGGUGAAAAUCCCGACCGGUGGUAAAGUCCACAAGCAUUUGCAUGAUUUGGUGAAAUUCCAAAACCGAUAGUACAGUCUAGAUGAAAGAAGAUUUGA
RS 2 dot …………((..(((…….)))..)).((((……))))…((((((…((((((((………..)))))…….)))))))))………….
RS 3 seq UAUCCAUCCAGAGCGGCCGAGAGAUCUGGCUCGUUGACGCCGCAGCAACCAUCCUGAAGGGUUCCGUAGCAGGAAUCGUGAGGGAAAGGUGCUCCCGCCAGAAGACGAUGGCGC
RS 3 dot …………(((((((((……..))))…..)))))((((.((.((((..(.((((((……)))))).)..))))..))))))..(((((……..))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table