Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA102706 Similarity: 0.960 Similarity: 0.959 Similarity: 0.959
UTR: 5HSAA102706
Gene: SPA17
MFE: -34.144
ENS: 0.843
Length: 160.
Predicted Ligands:
glucosamine - 18/20
Mn2+ - 1/20
cobalamin - 1/20
 RS: URS0000BF2A1A_1121290
MFE: -33.350
Ligand: glucosamine
Species: Clostridium acetireducens DSM 10703 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000BFDEC8_1262943
MFE: -41.924
Ligand: glucosamine
Species: Roseburia sp. CAG:197 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000BF569F_157838
MFE: -44.703
Ligand: glucosamine
Species: Bacillus shackletonii glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA102706 URS0000BF2A1A_1121290 URS0000BFDEC8_1262943 URS0000BF569F_157838
Length 160. 160. 159. 161.
Similarity - 0.960 0.959 0.959
Ensemble Norm 0.843 - - -
MFE -34.144 -33.350 -41.924 -44.703
Ligands - glucosamine glucosamine glucosamine
Gene SPA17 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.007 8.001 11.
Length SE - 0. 1. 1.
Lev Distance - 50. 51. 50.
UBS 8. 6. 9. 8.
BS 1. 0. 0. 0.
ILL 3. 1. 2. 1.
ILR 1. 1. 1. 3.
H 3. 4. 5. 4.
BL 2. 1. 2. 1.
BR 1. 0. 2. 1.
UN 0.194 0.275 0.170 0.174

Sequences

Field Description
UTR seq + 25 ucgccccuucucggccgccguaguuuuuuuuuuuuuuaaagaaaaaacgguuacccagcaacuagaaaaacaaccggaaccggcggcaccagcucggagagaaaggagguuccauaggcaguucuuaccaagaagATGTCGATTCCATTCTCCAACACCC
UTR dot + 25 ………….((((((…(((((((((((….)))))))))))((((.((………………..))))))))))))……..((((((…((((..((….((((.(((((…)))))..)))))))))).))))))…….
RS 1 seq UAUAAAUUAAAAGCGCCAGGACUUAAAAUGUAGAUAUUUUAAGUUGACGAGGAUGGGGAGUAUCGAAAUGUUCGGCGGAUGCCCCACGGUAUAACACUACCGUUAAAGAUUGAUAAAACUGAAAAGUGAUUUUUGGAACAAUAUCAAUUAGGUGUUAAUA
RS 1 dot ……………….(((((((((((….)))))))))))……….(((.(((((………….))))))))((((((……))))))….((((((((…(((((((….)))))))…..))))))))………..
RS 2 seq UUAAAAACUUUAGCGCUACGCAUCAGCAGGGGAAGCCUGUUGGUUCACGAGGUAUCAGGUCGUCGAAAAUUCAGCGGAUGCCUGGUCGUAGAUACGGACUGCGUAAUAUAACUACAAAUAUGAUGGAGACGUCAAAACAAAAGGUUAUAAUCCGUAAAU
RS 2 dot …………(((…)))(((((((((…..)))))))))..((.(((((((….(((.((….)).)))))))))).))(((((…….)))))…(((((((…….(((((….)))))……..)))))))……….
RS 3 seq UUUUAUUUAAAAGCGCCAGAACUAAACGUAGAGGUUUAGUUGACGAGGUGGAGGAGUAUCGAGGAUUUCGGCGGAUACCUCCCGGCUGCCACACACAGUCGAUGUCUUUUUCUUAAAACACUGAGGUGACUUGGUGCACAAAGGAAAAAGAAAAGUGGAAA
RS 3 dot ………….((((.(((((((((……))))))))..)..))))..((((((((………….))))).)))((((((…….))))))…((((((((((….(((((((….)))))))…..))))))))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table