Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA102737 Similarity: 0.987 Similarity: 0.986 Similarity: 0.985
UTR: 5HSAA102737
Gene: SPAG11B
MFE: -24.070
ENS: 0.989
Length: 77.
Predicted Ligands:
SAM - 7/20
fluoride - 5/20
cobalamin - 4/20
 RS: URS000231AB1B_75922
MFE: -26.211
Ligand: zmp-ztp
Species: Mycobacterium tusciae ZMP/ZTP riboswitch
 RS: URS0000DB0865_546874
MFE: -32.899
Ligand: cobalamin
Species: Friedmanniella sagamiharensis Cobalamin riboswitch
 RS: URS0000D97B98_366533
MFE: -21.373
Ligand: SAM
Species: Loktanella atrilutea SAM riboswitch (alpha-proteobacteria)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA102737 URS000231AB1B_75922 URS0000DB0865_546874 URS0000D97B98_366533
Length 77. 78. 78. 78.
Similarity - 0.987 0.986 0.985
Ensemble Norm 0.989 - - -
MFE -24.070 -26.211 -32.899 -21.373
Ligands - zmp-ztp cobalamin SAM
Gene SPAG11B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.003 3. 2.001
Length SE - 1. 1. 1.
Lev Distance - 16. 17. 18.
UBS 6. 7. 6. 6.
BS 0. 0. 0. 0.
ILL 2. 2. 1. 2.
ILR 1. 1. 1. 1.
H 2. 2. 2. 2.
BL 1. 2. 2. 2.
BR 2. 2. 3. 1.
UN 0.143 0.090 0.128 0.115

Sequences

Field Description
UTR seq + 25 cauauuugugcuccuucacgggagggcagggagguucaacggaccuuaaaacATGAGGCAACGATTGCTCCCGTCCG
UTR dot + 25 ……(((.(((((….))))).)))(((((…(((((..(((((…..)))))…)).))))))))…..
RS 1 seq GGUUAGCUUGACGACUGGCGCAGGUGGGACACCACCGGGAAGCGACGUUUGCACGCAUCGACCGCCUGGGUGUUCCUC
RS 1 dot …..(((((.((…..)))))))(((((((..(((((..((((.((……)).))).)..))))))))))))..
RS 2 seq GGAAGCCGGUGGGACUCCGGCACGGUCGCGCCACUGUGUGGGCCAGCCCUCGACCAGAGGGUGACGCCCGAGUCAGAC
RS 2 dot …….((((.((((…….)))).)))).((((.(((((..((((((…..))))))…))))).).)))..
RS 3 seq UAGCGACGACGUGGUGAUUUGAUGCCGGAUUGCGGGCCACGUUAAACAUUCCGCUAAAAGGGUUUGAGGGGUCUGCCC
RS 3 dot ……(((..((((……..))))..)))((((((.(.((((((…((…….)))))))).)))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table