Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA102912 Similarity: 0.988 Similarity: 0.988 Similarity: 0.987
UTR: 5HSAA102912
Gene: SPANXA1
MFE: -14.
ENS: 0.894
Length: 61.
Predicted Ligands:
fluoride - 14/20
unknown - 5/20
glutamine - 1/20
 RS: URS0000D90DBD_1797828
MFE: -18.085
Ligand: fluoride
Species: Deltaproteobacteria bacterium RBG_13_51_10 Fluoride riboswitch
 RS: URS0000BEDB01_690850
MFE: -15.746
Ligand: fluoride
Species: Desulfovibrio africanus str. Walvis Bay Fluoride riboswitch
 RS: URS0000D6BDC4_598467
MFE: -19.970
Ligand: unknown
Species: Brenneria sp. EniD312 nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA102912 URS0000D90DBD_1797828 URS0000BEDB01_690850 URS0000D6BDC4_598467
Length 61. 62. 61. 61.
Similarity - 0.988 0.988 0.987
Ensemble Norm 0.894 - - -
MFE -14. -18.085 -15.746 -19.970
Ligands - fluoride fluoride unknown
Gene SPANXA1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 3. 6.
Length SE - 1. 0. 0.
Lev Distance - 14. 15. 15.
UBS 5. 5. 6. 5.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 1.
ILR 1. 2. 2. 3.
H 1. 1. 1. 1.
BL 2. 2. 2. 2.
BR 2. 1. 1. 1.
UN 0.049 0.048 0.066 0.049

Sequences

Field Description
UTR seq + 25 aagccugccacugacauugaagaaccaauauauacaATGGACAAACAATCCAGTGCCGGCG
UTR dot + 25 ..(((.(.(((((..((((…..(((……….)))…..)))).)))))).))).
RS 1 seq AUUAUCUCCGGCGAUGGAGUCCGCCAGAACCGCCUUUCCAGGCUGAUGACUCCUGCCAAGGU
RS 1 dot …((((..((((..((((((.(((.(((……)))..)))….)))))))))).))))
RS 2 seq CGCCGCACAGGGGAUGGAGUCCCCCUUGAACCGCCAAGUUGCUGAUGACUCCUACUGUCGA
RS 2 dot …((.((((((((.(..(((…((((……))))…..)))..))))).)))))).
RS 3 seq GGGUGUCGGCUGUAUAGCGCAGUUAGGCAGGUUAUGAUUAUGCGUCGGUCGGGCCGCCACG
RS 3 dot ..(((.(((((..((.(((((((((………))))..)))))..))..))))).))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table