Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA102913 Similarity: 0.983 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA102913
Gene: SPANXA2
MFE: -14.873
ENS: 0.895
Length: 85.
Predicted Ligands:
cyclic-di-GMP - 8/20
glycine - 6/20
zmp-ztp - 4/20
 RS: URS0000AB69A1_869210
MFE: -35.147
Ligand: cyclic-di-GMP
Species: Marinithermus hydrothermalis DSM 14884 Cyclic di-GMP-II riboswitch
 RS: URS0000C6E1DC_1131935
MFE: -16.845
Ligand: cyclic-di-GMP
Species: Paenibacillus dendritiformis C454 Cyclic di-GMP-II riboswitch
 RS: URS0000C60D9E_1196322
MFE: -12.079
Ligand: cyclic-di-GMP
Species: Clostridium sp. Maddingley MBC34-26 Cyclic di-GMP-II riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA102913 URS0000AB69A1_869210 URS0000C6E1DC_1131935 URS0000C60D9E_1196322
Length 85. 84. 84. 84.
Similarity - 0.983 0.982 0.982
Ensemble Norm 0.895 - - -
MFE -14.873 -35.147 -16.845 -12.079
Ligands - cyclic-di-GMP cyclic-di-GMP cyclic-di-GMP
Gene SPANXA2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.005 3.004 12.018
Length SE - 1. 1. 1.
Lev Distance - 21. 22. 19.
UBS 6. 7. 6. 4.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 0.
ILR 1. 2. 2. 2.
H 2. 2. 1. 1.
BL 2. 2. 2. 1.
BR 2. 2. 1. 1.
UN 0.176 0.107 0.238 0.310

Sequences

Field Description
UTR seq + 25 acugagaagauucaaaaccuacaaaagccugccacugacauugaagaaccaauauauacaATGGACAAACAATCCAGTGCCGGCG
UTR dot + 25 ..(((……)))…………(((.(.(((((..((((…..(((……….)))…..)))).)))))).))).
RS 1 seq CGGGCCCUUGGAGGCGAUGAACCCUGCCCGUGAACUGGGCGCCUGGGGCGGGGGGAGCCAGUGGCGCAACCGGCCAAGGGAGGG
RS 1 dot …(((……)))……((((.(((.((..(((((((((…(((…….)))…)))))..)))).)).)))))))
RS 2 seq UAUAUAUUAGGAAACGAUGAAAUGCGCUUGUUGUCUGGGCACUUUAGGCGCGUGGAGUUAGUGGUGCAACCGGCCGAGUACAUU
RS 2 dot ………………..((((.(((((..(.(((((((((…(((…….)))…)))))..)))))))))).))))
RS 3 seq AUUAAAAUUGGAAACUGUGAAAAAUUCUCUUUAUUUGGGCACCUGGGGAAUUUGGAGUUAGUGGUGCAACCGGCCAAUAAUGAG
RS 3 dot ……………………..(((.(((((((((((((……………….)))))..)))…))))).)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table