Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA102915 Similarity: 0.981 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA102915
Gene: SPANXC
MFE: -9.629
ENS: 0.914
Length: 81.
Predicted Ligands:
SAM - 7/20
cyclic-di-GMP - 5/20
glycine - 3/20
 RS: URS0000DA75E0_1895689
MFE: -22.125
Ligand: SAM
Species: Candidatus Accumulibacter sp. 66-26 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000D0DBC8_1549949
MFE: -20.855
Ligand: SAM
Species: Bradyrhizobium vignae SAM_alpha
 RS: URS0002321F13_1262794
MFE: -11.832
Ligand: cobalamin
Species: Clostridium sp. CAG:306 AdoCbl variant RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA102915 URS0000DA75E0_1895689 URS0000D0DBC8_1549949 URS0002321F13_1262794
Length 81. 80. 80. 81.
Similarity - 0.981 0.980 0.980
Ensemble Norm 0.914 - - -
MFE -9.629 -22.125 -20.855 -11.832
Ligands - SAM SAM cobalamin
Gene SPANXC - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.009 4.049 2.026
Length SE - 1. 1. 0.
Lev Distance - 23. 24. 26.
UBS 4. 6. 4. 5.
BS 0. 0. 0. 0.
ILL 2. 2. 1. 2.
ILR 2. 2. 2. 2.
H 1. 2. 2. 1.
BL 0. 1. 1. 1.
BR 1. 1. 0. 1.
UN 0.333 0.237 0.113 0.173

Sequences

Field Description
UTR seq + 25 cgaagauucaaaaccuacaaaagccugccgcagacauugaagaaccaauauauacaATGGACAAACAATCCAGTGCCGGCG
UTR dot + 25 ……………………..((((((…((((…..(((……….)))…..))))….))).))).
RS 1 seq CCGGCCCAUAGCGCCGAUUUGACCGAUCAGCUUGCGGGCGCUCUACAAAUACGGCUAAAGCGGGGCGAGCCCAGUCCGCG
RS 1 dot .((((…….))))……………..((((((((((..(…..(.((….)).))..))))…)))))).
RS 2 seq CACUUAUCCCGUGGUGAUUUGAGCCGGCCGGCUUGCAGCCACGUUAAAUAAAUCGCUAAACAGGCCGGGGACCUCUGUGA
RS 2 dot ((((……..))))….(((….((((((((.(((……………)))…))))))))….)))…..
RS 3 seq AUAAUAAAAAGGAAUUGAAGGAAAGAAGUGCGAAAAUCACUCGCUGGUCCGCAGCCGUAAUAGCCGGAAUGCUUCAAUUGU
RS 3 dot …………((((((((.(…..(((((……….((((…..)))))))….))…..).))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table