Detected as a riboswitch by 7 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA102962 Similarity: 0.982 Similarity: 0.981 Similarity: 0.981
UTR: 5HSAA102962
Gene: SPATA17
MFE: -19.891
ENS: 0.851
Length: 80.
Predicted Ligands:
SAM - 7/20
fluoride - 4/20
zmp-ztp - 4/20
 RS: URS0000C31163_1414851
MFE: -13.896
Ligand: glycine
Species: Pelistega indica Glycine riboswitch
 RS: URS0000D85EFB_876364
MFE: -16.501
Ligand: fluoride
Species: Cupriavidus sp. USMAA2-4 Fluoride riboswitch
 RS: URS0000AB521F_290633
MFE: -23.444
Ligand: SAM
Species: Gluconobacter oxydans 621H SAM riboswitch (alpha-proteobacteria)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA102962 URS0000C31163_1414851 URS0000D85EFB_876364 URS0000AB521F_290633
Length 80. 79. 79. 80.
Similarity - 0.982 0.981 0.981
Ensemble Norm 0.851 - - -
MFE -19.891 -13.896 -16.501 -23.444
Ligands - glycine fluoride SAM
Gene SPATA17 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.008 1.093 3.
Length SE - 1. 1. 0.
Lev Distance - 22. 24. 25.
UBS 5. 6. 5. 6.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 0.
ILR 1. 0. 1. 1.
H 2. 3. 2. 2.
BL 2. 2. 1. 3.
BR 2. 2. 2. 2.
UN 0. 0.190 0.405 0.113

Sequences

Field Description
UTR seq + 25 caguuaccauggagaccgguaguaacaccaguuguaaacccaaggccaagagaccATGGCCACGTTAGCCCGGCTGCAAG
UTR dot + 25 ..(((((.((.(….).)).)))))..((((((………(((((……..)))))………))))))….
RS 1 seq AGUAGGUACUCUGGAGAGACUUGUUAGCAAGCGCCGAAGGUGAUUUAAAACUCUCAGGCACCAGGACAGAGGGGUGAAU
RS 1 dot ..(((((.(((….))))))))……….((((.(((……..))).)).))((((……….))))…
RS 2 seq GUUGACACAGGAGAUGGUGUUCCUCCUCUUUUGAAGAAACCGCAGCCGAAGAUGCGCUGCUGAUGACGCCUACAGAACC
RS 2 dot …..((.(((((..((….))..))))).))……..((((((……).)))))……………….
RS 3 seq GUGCCUGACCCUCGUGAUUUGAGCGGCCGGCUUGCGGCGAGGCUAAAGAACUGCGCUAAAGAGGCCCUGCGUCGUUAUCG
RS 3 dot ..(((.(.((((((…..)))).))).)))..((((((.((((………………))))…))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table