Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA102982 Similarity: 0.984 Similarity: 0.984 Similarity: 0.982
UTR: 5HSAA102982
Gene: SPATA19
MFE: -10.885
ENS: 0.931
Length: 76.
Predicted Ligands:
fluoride - 9/20
Ni/Co - 4/20
glutamine - 2/20
 RS: URS0000C7AEA4_12908
MFE: -25.435
Ligand: Ni/Co
Species: unclassified sequences NiCo riboswitch
 RS: URS0000D66326_12908
MFE: -25.435
Ligand: Ni/Co
Species: unclassified sequences NiCo riboswitch
 RS: URS0000C437C2_1194083
MFE: -29.931
Ligand: fluoride
Species: Tetrasphaera japonica T1-X7 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA102982 URS0000C7AEA4_12908 URS0000D66326_12908 URS0000C437C2_1194083
Length 76. 75. 75. 76.
Similarity - 0.984 0.984 0.982
Ensemble Norm 0.931 - - -
MFE -10.885 -25.435 -25.435 -29.931
Ligands - Ni/Co Ni/Co fluoride
Gene SPATA19 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.005 3.005 0.003
Length SE - 1. 1. 0.
Lev Distance - 20. 20. 24.
UBS 5. 4. 4. 5.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 1.
ILR 1. 0. 0. 1.
H 4. 4. 4. 4.
BL 0. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0.158 0.227 0.227 0.105

Sequences

Field Description
UTR seq + 25 agcuucaauggaaggagggagccaagaagggggccugguauacauucaaagATGATAATTACGACATGGATTGTGT
UTR dot + 25 ..((((….))))..(((..((……))..)))……((((….))))((((((……..))))))..
RS 1 seq ACAGUACAAGCUGAUCAGGCCGUAAAACCGGCCGGGCCUUACGGCAGCAGAUUAUCCUACAUCUGCGGGACAGGA
RS 1 dot .((((….))))….(((((……)))))..(((….))).((((((……..))))))………
RS 2 seq ACAGUACAAGCUGAACAGGCCGUAAAACCGGCCGGGCCUUACGGCAGCAGAUUAUCCUACAUCUGCGGGACAGGA
RS 2 dot .((((….))))….(((((……)))))..(((….))).((((((……..))))))………
RS 3 seq GUGGGCCCCGGCGAUGGAUCCCGCCAGGACGCGCAGCGUCCGAACUGCCGCCCCGGCUGAUGGCUCCUGCUCCGUC
RS 3 dot (((((..(((….)))..)))))..((((((…))))))…..((((…)))).(((((……..)))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table