Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA103223 Similarity: 0.970 Similarity: 0.970 Similarity: 0.969
UTR: 5HSAA103223
Gene: SPCS3
MFE: -52.788
ENS: 0.969
Length: 121.
Predicted Ligands:
SAM - 9/20
TPP - 4/20
FMN - 3/20
 RS: URS0000ABCD7C_446462
MFE: -48.585
Ligand: FMN
Species: Actinosynnema mirum DSM 43827 FMN riboswitch (RFN element)
 RS: URS0000BE3D05_1283842
MFE: -32.882
Ligand: TPP
Species: Stachybotrys chartarum IBT 40288 TPP riboswitch (THI element)
 RS: URS0000C7DE97_1126833
MFE: -30.694
Ligand: glycine
Species: Paenibacillus beijingensis Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA103223 URS0000ABCD7C_446462 URS0000BE3D05_1283842 URS0000C7DE97_1126833
Length 121. 122. 122. 120.
Similarity - 0.970 0.970 0.969
Ensemble Norm 0.969 - - -
MFE -52.788 -48.585 -32.882 -30.694
Ligands - FMN TPP glycine
Gene SPCS3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 10.003 4.004
Length SE - 1. 1. 1.
Lev Distance - 36. 34. 38.
UBS 12. 10. 12. 11.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 3.
ILR 5. 4. 6. 5.
H 1. 1. 1. 1.
BL 4. 4. 7. 5.
BR 3. 2. 3. 2.
UN 0.017 0.049 0.074 0.083

Sequences

Field Description
UTR seq + 25 gcaccgcagacggcgcggaucgcagggagccgguccgccgccggaacgggagccugggugugcguguggaguccggacucgugggagacgaucgcgATGAACACGGTGCTGTCGCGGGCGA
UTR dot + 25 ((.((((.((((((((.((((((.(((((((((((((((((..(..(((….)))..)..))).)))))..)))).)))………..)))))))…..).))))))))))))))..
RS 1 seq CACGCGCUCCGGGGCUCGGUGAAAUCCCGAACCGGCGGUGAGAGCCCGCGAACCGCCGCCAGGCGGCCGACCCGGUGGGAUUCCGGGGCCGACGGUCACAGUCCGGAUGAGAGGUGCGCAGC
RS 1 dot ..(((((((((((((((.(.(.((((((..(((((((((….(((.(((……)))..))).))))..))))))))))))).)))))…………)))))……)))))….
RS 2 seq GCAGCUCACUACGGGUGCCGAGUGGAAGCAGGCUCUUCGAAGCCUGUGGACACGAAGCUGAGAUUGUACCGUUACUACUCGAUCAAGUUAAUGCUUGCGUGGGAAAGUGCUGCUGCUCCAAA
RS 2 dot (((((((.(((((.(.(((((((((.(((.((..(.((..(((.(((….)))..)))..))..)..))))).)))))))………..)).).)))))))….)))))………
RS 3 seq AUGACGAUGGCAGGGAGAGACCGGGCGGACAAUCUAGGAUCGCCAGGCACCGAAGGAGCAAGUCGACGGCCAGCCAGCCGGACGAUUAAUCUCUCAGGUAAAAAGAACCGCCAUCCGACG
RS 3 dot …..((((((.((((((((((((..((…..((.((.(((.(..((.((…)).))..).)))…))))))..))))……..))))))…………))))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table