Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA103229 Similarity: 0.943 Similarity: 0.941 Similarity: 0.941
UTR: 5HSAA103229
Gene: SPDYA
MFE: -78.421
ENS: 0.778
Length: 214.
Predicted Ligands:
cobalamin - 9/20
FMN - 3/20
glucosamine - 3/20
 RS: URS00000624CD_224308
MFE: -65.709
Ligand: leucine
Species: Bacillus subtilis subsp. subtilis str. 168 T-box riboswitch specific of leucine tRNA ligase
 RS: URS00019FCFCD_1748965
MFE: -75.114
Ligand: cobalamin
Species: uncultured Desulfatiglans sp. Cobalamin
 RS: URS000232EBE1_1348163
MFE: -75.663
Ligand: cobalamin
Species: Desulfocarbo indianensis Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA103229 URS00000624CD_224308 URS00019FCFCD_1748965 URS000232EBE1_1348163
Length 214. 215. 215. 213.
Similarity - 0.943 0.941 0.941
Ensemble Norm 0.778 - - -
MFE -78.421 -65.709 -75.114 -75.663
Ligands - leucine cobalamin cobalamin
Gene SPDYA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.001 8.002 7.004
Length SE - 1. 1. 1.
Lev Distance - 70. 73. 74.
UBS 15. 14. 14. 15.
BS 0. 0. 1. 1.
ILL 4. 5. 4. 3.
ILR 4. 2. 3. 4.
H 6. 5. 6. 6.
BL 5. 4. 3. 6.
BR 2. 3. 3. 4.
UN 0.131 0.098 0.088 0.070

Sequences

Field Description
UTR seq + 25 agcgaccgacgagcaaccgucugaggccaggagcgcugcgacggagccuugaccgccguugcccggcccucucccgcgcagccccgggcuuccgcaguccuuccuucagaagggaaauuucugagggucaggaaggggaaucuguaccucacuccuugaacaccaaggaaggaauauugggaaaccaaaATGAGGCACAATCAGATGTGTTGTG
UTR dot + 25 …….((((……)))).((((((.((.(.((((((..((((……..((((…..))))…))))..))))))))).))))))(.(..((((.((((((((((…..))))))))))..))))..).)……..(((…((((((…..)))))))))….((((….))))…..((((((……))))))…
RS 1 seq AUAAGAACAAUGAAGAGGAGCAGUAAGAAACAGAUAUUGUUGCAGAGAGUUGACGGCUGGUGAAAGUCAAUCAAGUUUGUUUCCGAACUCACCUCAGAGUUGCAGCGGUGAAAAGCCGCUGACGCAUAACUGCGUUAAAAGUAUCAAGUGAGUGCGGCGUAUGCCGCGCUAACGAGGGUGGUACCGCGGGAAAACGAAAGUCUCUCGUCCCUUUU
RS 1 dot …….((((…((((.(.(((..(((((((((.(((………((((((………..))))))))))))))))))…)))).))))…))))(((((((…..)))))))(((((….)))))…………((.((((((((….)))))))).))(((((…….((((((..((….)).)))))))))))..
RS 2 seq GGAAGAUUCGCACGUUCAGGUGCCCGCAAGGGCUUAAAAGGGAACUCCCUUGAAAACGGGGACGGACCCGCCGCUGUGACUCCGCUCCUUUUCCCCUAUCCCGCAGGAAAAGGAAACCUCCCGGCCCAGAGAAGCCACUGUCCGAUGCCUUCGGAUGGGAAGGCCGCCGAGAGGGCGGAGGAGUCAGAAGACCUGCCUGAACAGGGGUACAAGAC
RS 2 dot ………((((……)))).((((..(((……(((..((((((…….))))).)..))))))..)))).(((((((((((((((………..)))))))))..((((.((((……..(((.((((((((…..))))))))…))).)))).))))))))))(.(((….))))(((((……)))))……
RS 3 seq UGUCCUGCCCCGAGGAUGGGUCCCUAACGGGGUUAAAAGGGAAGACGGUGCGAAUCCGUCACGGUCCCGCCGCUGUAACCGGGGACGAAAGCCGCAGGCAACUCGCCGGGUCUCAUGGAGCCGGUAAUUGUCAAGCCACUGCCGAAAGGCGGGAAGGCGCGGCAAGUAGAUUGAUCUGGAAGUCAGAAGACCUGCCUGUCCUGAAAUAGACCC
RS 3 dot .(((((……)))))..((((((.(((((((…..((((.(((((…….)))))….))))))).))))….))))))….(((((.(((((…(((((.(((…))).)))))..)))))..(((.(((((….)))))…))))))))..((((.((..((((…..)))).)).))))((((……))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table