Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA103232 Similarity: 0.958 Similarity: 0.954 Similarity: 0.954
UTR: 5HSAA103232
Gene: SPDYA_0
MFE: -58.254
ENS: 0.955
Length: 157.
Predicted Ligands:
FMN - 5/20
glycine - 4/20
Mg2+ - 3/20
 RS: URS0000DA7FB8_225345
MFE: -31.234
Ligand: glycine
Species: Clostridium chromoreductans Glycine riboswitch
 RS: URS0000C37002_1768196
MFE: -36.462
Ligand: Mg2+
Species: Erysipelotrichaceae bacterium MTC7 M-box riboswitch (ykoK leader)
 RS: URS0000C12A63_47763
MFE: -62.864
Ligand: TPP
Species: Streptomyces lydicus TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA103232 URS0000DA7FB8_225345 URS0000C37002_1768196 URS0000C12A63_47763
Length 157. 159. 155. 157.
Similarity - 0.958 0.954 0.954
Ensemble Norm 0.955 - - -
MFE -58.254 -31.234 -36.462 -62.864
Ligands - glycine Mg2+ TPP
Gene SPDYA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13. 8. 10.002
Length SE - 4. 4. 0.
Lev Distance - 45. 52. 58.
UBS 11. 11. 11. 11.
BS 0. 0. 0. 0.
ILL 5. 4. 3. 6.
ILR 1. 4. 3. 3.
H 4. 3. 4. 4.
BL 2. 1. 2. 1.
BR 3. 2. 3. 1.
UN 0.121 0.138 0.135 0.076

Sequences

Field Description
UTR seq + 25 ggguaccgcugcuggcuagcgaccgacgagcaaccgucugaggccaggagcgcugcgacggagccuugaccgccguugcccggcccucucccgcgcagccccgggcuuccgcaggaauauugggaaaccaaaATGAGGCACAATCAGATGTGTTGTG
UTR dot + 25 ……((((.((((((..((…((((……)))))).)))))).))))(((((..(((((…..(((..(((((.(((…….))).)))))..)))))))))))))…..((((….))))…..((((((……))))))…
RS 1 seq GGACGAAACUCUGGAGAGACUCAUUUAAUUAUGAGCACCGAAGGAGCAAGGUAACUAUAGUAAUUUAAUAUGGUUUCUAAAGUGAAUUAUUUUCAGAAACCUUGAAAUAAACUAUUUAAAGUUACUGAAACUCUCAGGUAAAAGGACAGGGGAUAGGAU
RS 1 dot ……..((((((…(.(((((……)))))).))…))))…((((((((((((..(((((…(((((((((((((…)))))).))))))))))))….)))))….)))))))…..((((..((……))..))))……
RS 2 seq UAGAAAAACCGGUAAGUAAGGUUACUGUAGGGAUACGGGUUGCUGCCGCAAAAUAGUGGAGACACUAUGCGCUGGUUAGCAGGGAUGAUCGAUUCAAGGUCAUACCUAAUGCAAUUUCAUCGCCCUACAAAGCUAAAGCUCAAACGGAAAUGUCA
RS 2 dot ………((((.(((((…..(((((….))))).)))))))))….((((((….))))))(((.(((…((((((((((((…….)))))).)))..)))….))).)))((…..(((….)))…..))……..
RS 3 seq CUUUGCAAUCGCGGGAGCUCGGAGCACCGGGCUGAGAGGGCGCUGACCUUCGUCCCAGCGGUGUUUCACGUGAAACACCGGCGGACGGAAGCCGCUGCGUCGACCGCCGAACCUGUUACCGGGUAAUGCCGGCGUAGGGAGUUGGGUCUCCAUGACU
RS 3 dot ….((..((.(…(((((((….)))))))).))..))(((….(((((((…(((((((((….)))))))))..))))))))))..((((((((…((…(((((….)))))…))))))))))((((……))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table