Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA103257 Similarity: 0.989 Similarity: 0.989 Similarity: 0.989
UTR: 5HSAA103257
Gene: SPG11
MFE: -15.250
ENS: 0.977
Length: 56.
Predicted Ligands:
unknown - 17/20
glutamine - 3/20

 RS: URS0000E606D5_1915074
MFE: -23.392
Ligand: unknown
Species: Sphingomonas jeddahensis sul1 RNA
 RS: URS0000D6A5F8_1736382
MFE: -21.492
Ligand: unknown
Species: Methylobacterium sp. Leaf456 sul1 RNA
 RS: URS0000E5FC14_943830
MFE: -22.145
Ligand: unknown
Species: Rhodopseudomonas sp. R-45977 sul1 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA103257 URS0000E606D5_1915074 URS0000D6A5F8_1736382 URS0000E5FC14_943830
Length 56. 56. 56. 56.
Similarity - 0.989 0.989 0.989
Ensemble Norm 0.977 - - -
MFE -15.250 -23.392 -21.492 -22.145
Ligands - unknown unknown unknown
Gene SPG11 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 3. 1.001
Length SE - 0. 0. 0.
Lev Distance - 14. 14. 15.
UBS 3. 3. 3. 3.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 2.
ILR 1. 1. 1. 1.
H 1. 1. 1. 1.
BL 0. 1. 1. 0.
BR 0. 0. 1. 1.
UN 0.107 0.143 0.125 0.071

Sequences

Field Description
UTR seq + 25 gaaagugaccggaaguaaccgccgggccaagATGGCTGCAGAGGAAGGGGTCGCGA
UTR dot + 25 ….((((((……….((..(((((…)))))))………))))))..
RS 1 seq CAAGGACCCGGUGCAACCCCGGGUGGCUAUCCCGGCCGCCGAUCCGCCGGGCAACU
RS 1 dot ….(.(((((((……..(((((((…..)))))))….))))))))….
RS 2 seq CCUGGACCCGGUGCAAGCCCGGGUGGCUCUUCCGGCCGCCGAUCCGCCGGAUCACG
RS 2 dot ….((.((((((……..(((((((…..)))))))….)))))).))…
RS 3 seq UCUGGACCCGGUGAAACCCCGGGUGGCUCUUCCGGCCGCCGAUCCGCCGGACCACG
RS 3 dot ..(((..((((((……..(((((((…..)))))))….)))))).)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table