Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA103380 Similarity: 0.982 Similarity: 0.981 Similarity: 0.981
UTR: 5HSAA103380
Gene: SPIRE1
MFE: -22.133
ENS: 0.980
Length: 72.
Predicted Ligands:
fluoride - 12/20
homocysteine - 4/20
cobalamin - 2/20
 RS: URS0000DB4D98_210143
MFE: -18.709
Ligand: fluoride
Species: Corchorus capsularis Fluoride riboswitch
 RS: URS0000C2FD3D_1263073
MFE: -13.954
Ligand: fluoride
Species: Dorea formicigenerans CAG:28 Fluoride riboswitch
 RS: URS0000D85B45_1686310
MFE: -23.825
Ligand: cobalamin
Species: Bartonella apis Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA103380 URS0000DB4D98_210143 URS0000C2FD3D_1263073 URS0000D85B45_1686310
Length 72. 73. 73. 71.
Similarity - 0.982 0.981 0.981
Ensemble Norm 0.980 - - -
MFE -22.133 -18.709 -13.954 -23.825
Ligands - fluoride fluoride cobalamin
Gene SPIRE1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.006 1.009 2.001
Length SE - 1. 1. 1.
Lev Distance - 23. 24. 24.
UBS 5. 4. 5. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 1. 0.
H 4. 4. 4. 3.
BL 1. 0. 1. 1.
BR 0. 0. 0. 0.
UN 0.153 0.233 0.247 0.183

Sequences

Field Description
UTR seq + 25 gacgccggcacacggcgcgacugccgagcgcagcgcccacccgcgggATGGAAACAGAGGTCATTGAATCTT
UTR dot + 25 ..(((((…..)))))((.((((…..))))))(((……)))………(((((……)))))
RS 1 seq UGCGCGCUUGGAGAUGGCGUUCCUCCUGGGAAACCGAACCGCAGCAUUCGCUGCCGAUGACGCCUACAGUUAC
RS 1 dot …(((((…….)))))……(((….)))….(((((….)))))…((((…….)))).
RS 2 seq UCUCAGACAGGGAAUGAGGUUCUCCCUCAAUUACGAUUGAAACCGCCAAAUGGCUGAUGACUUCUGUGAAUCG
RS 2 dot ((((…..)))).(((((…..)))))……………(((….))).(((.((….))..))).
RS 3 seq GGAACCCGGUGUCAAUCCGGGGCGGUCGCGCCACUGUGACUGUCUACCAAUCAUGGGACAGAAGCCAGAAC
RS 3 dot …..((((…….))))(((((((((……)))))))))……((.(((……..)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table