Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA103387 Similarity: 0.976 Similarity: 0.968 Similarity: 0.965
UTR: 5HSAA103387
Gene: SPIRE1_0
MFE: -48.044
ENS: 0.825
Length: 124.
Predicted Ligands:
TPP - 6/20
glycine - 4/20
SAM - 4/20
 RS: URS0000D7E969_147645
MFE: -46.714
Ligand: TPP
Species: Paracoccus yeei TPP riboswitch (THI element)
 RS: URS00023249C4_1797193
MFE: -38.867
Ligand: cobalamin
Species: Acidobacteria bacterium RIFCSPLOWO2_12_FULL_67_14b Cobalamin riboswitch
 RS: URS0000C7ECE1_99158
MFE: -36.146
Ligand: cobalamin
Species: Hammondia hammondi Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA103387 URS0000D7E969_147645 URS00023249C4_1797193 URS0000C7ECE1_99158
Length 124. 124. 123. 125.
Similarity - 0.976 0.968 0.965
Ensemble Norm 0.825 - - -
MFE -48.044 -46.714 -38.867 -36.146
Ligands - TPP cobalamin cobalamin
Gene SPIRE1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 10. 4.002
Length SE - 0. 1. 1.
Lev Distance - 30. 36. 43.
UBS 13. 13. 12. 12.
BS 0. 0. 0. 0.
ILL 4. 4. 4. 4.
ILR 5. 4. 5. 6.
H 2. 2. 2. 1.
BL 5. 6. 2. 4.
BR 4. 5. 4. 4.
UN 0.073 0.048 0.057 0.024

Sequences

Field Description
UTR seq + 25 uccggggauggugaggcggcggcgcgcgacgacgaugcuccggagcugaggagacgccggcacacggcgcgacugccgagcgcagcgcccacccgcgggATGGAAACAGAGGTCATTGAATCTT
UTR dot + 25 (((((((..((((..(((.(((((..((.((.((.((..((((.(((….)).).))))..)))).))))..)))))..)))..))))..))).))))………(((((……)))))
RS 1 seq UUCGCCACCAAGGGGAGUCCCGGCAAGGGGCUGAGAGUUCGCUGGCGUCCCGGAAUGGGCGGCGCGAUGACCCUUAGAACCUGAUCCGGAUCAUGCCGGCGAAGGGAUGGGAGAGAUGCGCCUG
RS 1 dot ((((((…..((.(.(..((((..(((..(((((.((((((.(.(((((……))))).)))))..)).)))))..)))…))))..).).))))))))…..(((.(…..).))).
RS 2 seq UCCUAACCUCAACCGACGCGUACCCGGGCAGGCAGGGAAGUUGGGUGCAAAGCCCACACGGUCCCGCCACUGUGAGCGGUCACGAUCCGCGAGUCAGGAAACUGCCGGUCCAAGGGGCAUGUC
RS 2 dot ((((…(((…((…(((((((..((((((.((((.(((((((…..))))).))..)))))))..)))..).))).)))…)).)))..))))…((((………))))….
RS 3 seq ACCCUAGAUGAACAUGACGGUUCUUUGAUGAGAUGAAAAGGGAAUGCGGUGCGGGGAAACCUCCCCAAGGCCGCGGCUGCCCCCGCAACUGUAUGCGGUGAAUCCUUCGUCAGAUGCCACUGGGA
RS 3 dot ..(((((.((.(..(((((((((.((((((((.((….(((..((((((..(((((….)))))…))))))….)))…)).)).))).))).))))….)))))..)..))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table