Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA103576 Similarity: 0.979 Similarity: 0.979 Similarity: 0.978
UTR: 5HSAA103576
Gene: SPRR2A
MFE: -24.654
ENS: 0.648
Length: 86.
Predicted Ligands:
cyclic-di-GMP - 4/20
glycine - 3/20
TPP - 3/20
 RS: URS0000C52CC2_352165
MFE: -38.107
Ligand: Ni/Co
Species: Pyramidobacter piscolens W5455 NiCo riboswitch
 RS: URS000233004A_944560
MFE: -26.036
Ligand: SAM
Species: Actinomyces sp. oral taxon 175 str. F0384 SAM riboswitch (S box leader)
 RS: URS0000BA963F_1183433
MFE: -23.809
Ligand: glycine
Species: Agrobacterium fabrum str. J-07 Glycine
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA103576 URS0000C52CC2_352165 URS000233004A_944560 URS0000BA963F_1183433
Length 86. 85. 85. 84.
Similarity - 0.979 0.979 0.978
Ensemble Norm 0.648 - - -
MFE -24.654 -38.107 -26.036 -23.809
Ligands - Ni/Co SAM glycine
Gene SPRR2A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 5. 7.001
Length SE - 1. 1. 4.
Lev Distance - 25. 26. 22.
UBS 7. 7. 7. 7.
BS 0. 0. 0. 0.
ILL 4. 3. 3. 4.
ILR 1. 2. 1. 2.
H 2. 2. 2. 1.
BL 0. 1. 2. 2.
BR 1. 3. 1. 2.
UN 0.105 0.106 0.118 0.131

Sequences

Field Description
UTR seq + 25 aaaccccugguaccugagcacugaucugccuuggagaaccugauccugagacuccagcaggATGTCTTATCAACAGCAGCAGTGCA
UTR dot + 25 ..(((…)))……((((((..((((..((..((………(((((((((….))).))))))))..)))))))))))).
RS 1 seq ACGGCACAAACUGAACAGGCCGUCCCCUCGGGGAGCGGGCCGGGCCGCCGCGGCGCGGCAGCGGACGACGAUCCGCGGGACGGAA
RS 1 dot .(((……)))……(((((((..((((..(((..(((.(((((……)))))..))).)).)..)))).)))))))..
RS 2 seq CGACCAUCCAGAGCGGCCGAGAGACCUGGUUCCAUGACGCCGCAGCAACCCGGUACGCGGGUGCUUCAGCCAGGAUCGAUGGAGA
RS 2 dot …….((…..))(((.((..((((((….(((……(((.(((((…..))))))))))))))))).))..)))…
RS 3 seq GAACUCUGGAGAGAAGCCACCUUGAUCUAAGGACGGCUCGCCGAAGGGAUAACAAUCUCAGGCGACAAGGACAGAGGGGGCUCU
RS 3 dot ………..((.((((.((((..(((..(……(((((…(((((….))))).))))))..)))..)))).))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table