Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA103797 Similarity: 0.990 Similarity: 0.986 Similarity: 0.986
UTR: 5HSAA103797
Gene: SRC
MFE: -18.016
ENS: 0.952
Length: 64.
Predicted Ligands:
fluoride - 16/20
unknown - 4/20

 RS: URS0000BE34D8_717785
MFE: -18.006
Ligand: fluoride
Species: Hyphomicrobium sp. MC1 Fluoride riboswitch
 RS: URS0000CF85F4_2043167
MFE: -14.346
Ligand: fluoride
Species: Syntrophobacter sp. SbD1 crcB
 RS: URS0000BEAA5F_272568
MFE: -16.448
Ligand: fluoride
Species: Gluconacetobacter diazotrophicus PAl 5 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA103797 URS0000BE34D8_717785 URS0000CF85F4_2043167 URS0000BEAA5F_272568
Length 64. 63. 62. 64.
Similarity - 0.990 0.986 0.986
Ensemble Norm 0.952 - - -
MFE -18.016 -18.006 -14.346 -16.448
Ligands - fluoride fluoride fluoride
Gene SRC - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.004 3.001 2.006
Length SE - 1. 4. 0.
Lev Distance - 10. 13. 18.
UBS 4. 5. 4. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 1.
ILR 2. 1. 1. 1.
H 2. 2. 2. 2.
BL 1. 2. 1. 1.
BR 0. 2. 1. 0.
UN 0.141 0.079 0.177 0.219

Sequences

Field Description
UTR seq + 25 caucgagguuuugagaggcuaacucucccaaaaaggaccATGGGTAGCAACAAGAGCAAGCCCA
UTR dot + 25 ……(((((((((((…..)))))……))))))..((((.((…….))..)))).
RS 1 seq GUAAGCGAUGGGGAUGGGGUUCCCCCGAUAACCGCCAUUGUGGCUGAUGACUCCUACGAUAGC
RS 1 dot ….(((((((((.(((((…)))))….)).))))))).((((.((…….)).))))
RS 2 seq AUAUCCAGUGGUGAUGGAGUCCACCCACGACCGCCUUUUCGGCUGAUGACCCCUACCCGAGC
RS 2 dot …….(((((..(((…….)))..)))))…(((((.((……..)).))))).
RS 3 seq CGUCCGGUCGGAGAUGGAGUACCUCCGUAUAACCGCCCCCAGGGCUGAUGACUCCUGCUCGCAU
RS 3 dot …..((.(((..((((((…))))))….)))))..(((((……..)))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table