Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA103832 Similarity: 0.982 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA103832
Gene: SRGAP1
MFE: -10.719
ENS: 0.986
Length: 81.
Predicted Ligands:
cobalamin - 4/20
zmp-ztp - 4/20
SAM - 3/20
 RS: URS0000D973C7_1121302
MFE: -10.037
Ligand: cyclic-di-GMP
Species: Clostridium cavendishii DSM 21758 Cyclic di-GMP-II riboswitch
 RS: URS0000C65DFB_1519490
MFE: -33.760
Ligand: cobalamin
Species: Streptomyces sp. NRRL WC-3618 Cobalamin riboswitch
 RS: URS0000C45655_1423734
MFE: -14.723
Ligand: SAM
Species: Lactobacillus composti DSM 18527 = JCM 14202 SMK box translational riboswitch (SAM-III)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA103832 URS0000D973C7_1121302 URS0000C65DFB_1519490 URS0000C45655_1423734
Length 81. 81. 83. 82.
Similarity - 0.982 0.980 0.980
Ensemble Norm 0.986 - - -
MFE -10.719 -10.037 -33.760 -14.723
Ligands - cyclic-di-GMP cobalamin SAM
Gene SRGAP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.030 1. 6.024
Length SE - 0. 4. 1.
Lev Distance - 24. 22. 24.
UBS 5. 4. 5. 4.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 1.
ILR 2. 2. 2. 0.
H 3. 2. 3. 3.
BL 0. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0.185 0.358 0.181 0.341

Sequences

Field Description
UTR seq + 25 guugugaccacugaacaaaacuugcccauugaaagcaaacccggaacagcuggauaATGTCCACCCCGAGCCGATTCAAGA
UTR dot + 25 .((((………))))…((((………))))…(((..(…(((((…)))))….)..)))……..
RS 1 seq UAUUUAGAAGGGAACGAUGAAAUAAAUCUUAAUUUGGGCACUUUAGAUUUAUGGAGUUAGUAGUGCAACCGACCUCAGUUG
RS 1 dot ……………(((…….)))…..(((((((((…(((((…)))))…)))))..))))………
RS 2 seq GGAAGCCGGUGAGAAUCCGGCACGGUCGCGCCACUGUAAGCCCCGUACGCACCCGCCUGGUGCGGCCCGGGGGCAAGUCAGAC
RS 2 dot ….(((((…….)))))(((((……)))))..((((((..((((((…..))))))..)..)))))………
RS 3 seq AUAAGUUGACUAUCAUUCCCGAUAGGAUUCGCUGCGUGCGAAGUACCUUGUAACCUACGAAGAGGGGGAAAUAUUUUUUAUG
RS 3 dot ………(((((……)))))..(((((…..)))))…(((…..(((……))))))…………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table