Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA103976 Similarity: 0.983 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA103976
Gene: SRXN1
MFE: -11.935
ENS: 0.743
Length: 78.
Predicted Ligands:
SAM - 13/20
cobalamin - 2/20
fluoride - 2/20
 RS: URS0000D8447A_1121322
MFE: -12.459
Ligand: zmp-ztp
Species: Anaerocolumna jejuensis DSM 15929 ZMP/ZTP riboswitch
 RS: URS0000D664F9_12908
MFE: -25.022
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
 RS: URS0002327E24_1201290
MFE: -10.442
Ligand: cobalamin
Species: Bacteriovorax sp. BAL6_X AdoCbl variant RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA103976 URS0000D8447A_1121322 URS0000D664F9_12908 URS0002327E24_1201290
Length 78. 78. 79. 78.
Similarity - 0.983 0.982 0.982
Ensemble Norm 0.743 - - -
MFE -11.935 -12.459 -25.022 -10.442
Ligands - zmp-ztp GMP cobalamin
Gene SRXN1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 2.015 3.008
Length SE - 0. 1. 0.
Lev Distance - 21. 22. 23.
UBS 4. 5. 3. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 1.
ILR 1. 1. 1. 1.
H 2. 2. 2. 1.
BL 0. 2. 0. 1.
BR 1. 2. 0. 1.
UN 0.179 0.179 0.304 0.269

Sequences

Field Description
UTR seq + 25 gacaauaggaucauggccuuacccuugaagcauuaccgagaaggagaacagagATGGGGCTGCGTGCAGGAGGAACGC
UTR dot + 25 …………..((((((((((((…………..)))).)……..)))))))((((………))))
RS 1 seq UAUAGAUUAUACGACUGACGGAAGUGGAAUCAACCACAUGAAGUAUAAUAAUAAAAGCCGACCGUCUGGGCGAGAGCC
RS 1 dot …………..(.((((((.((((……)))).)………………….))))).)(((….)))
RS 2 seq UCUAAUGGAAGCGAAGAAACGCCCUGCCUAAACGGGCACCAUGGUGGGGCGUGGAGCGAGUGGUGCGACCGACCUCGGA
RS 2 dot ………………((((((((((…………..))))))))))….((((((((…))))..))))..
RS 3 seq CAAAUACAGCAUAAAAGGUGAACUCUGUGAAAUUCAGAGACUGUCCCGCAACGGUUAGAGUCCGAGCCCUUCAAUAUU
RS 3 dot …………..((((((.(((((…………((((((……))))))))))).))…))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table