Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA103977 Similarity: 0.977 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA103977
Gene: SS18
MFE: -37.873
ENS: 0.899
Length: 103.
Predicted Ligands:
SAM - 14/20
TPP - 2/20
purine - 2/20
 RS: URS0000DB3832_550447
MFE: -37.317
Ligand: SAM
Species: Bacillus sp. MNA4 SAM riboswitch (S box leader)
 RS: URS0000C4EA76_396014
MFE: -38.242
Ligand: TPP
Species: Brachybacterium phenoliresistens TPP riboswitch (THI element)
 RS: URS0000C191CC_1679168
MFE: -29.717
Ligand: SAM
Species: Bacillus sp. FJAT-27231 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA103977 URS0000DB3832_550447 URS0000C4EA76_396014 URS0000C191CC_1679168
Length 103. 103. 104. 104.
Similarity - 0.977 0.976 0.976
Ensemble Norm 0.899 - - -
MFE -37.873 -37.317 -38.242 -29.717
Ligands - SAM TPP SAM
Gene SS18 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.005 10.001 13.011
Length SE - 0. 1. 1.
Lev Distance - 28. 27. 26.
UBS 7. 8. 8. 8.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 2.
ILR 3. 3. 1. 2.
H 3. 3. 3. 3.
BL 0. 2. 2. 1.
BR 0. 1. 1. 3.
UN 0.068 0.136 0.106 0.173

Sequences

Field Description
UTR seq + 25 gagaggccggcgucucucccccaguuugccguucacccggagcgcucgggacuugccgauaguggugacggcggcaacATGTTGGATGACAATAACCATCTTA
UTR dot + 25 (((((((….)))))))…((..((((((((((((….((..((((……))))..)))))))..)))))))..))..(((((……..)))))..
RS 1 seq CUCUUAUGCAGAGAGGCGGAGGGACCGGCCCGAUGAUGCCCGGCAACCACCCGAACAGGGCAAGGUGCCAAUUCCGGAGGCGCUGCUGCGCCGGACAUGAGAG
RS 1 dot (((((…..))))).((((((.(((.((((…..((..(((…….)))..))))))..))).))…))))..(((((….)))))………..
RS 2 seq CAUCCACGACAGGGGAGCACCGCACGGUGCUGAGAGUGCGCACGGCGCAGACCCUCGAACCUGAUCCGGCUCGCACCGGCGGAGGGAGUCGGGACUUCUCGGCG
RS 2 dot ..(((.(….).)))…((((.((((((…((((…..(((..(((……….)))..)))))))))))))))))…..((((((….)))))).
RS 3 seq UUCUUAUCAAGAGAAGCGGAGGGACUGGCCCGAUGAUGCUUCAGCAACCGGCUGCGUAAAGUCAAGGUGCUAAUUCCAGCGGGAUCCAUCCCGAAAGAUGAGAG
RS 3 dot (((((…..)))))…..((((.(((((((((..(((..((((…..)))).)))..)))..)).)))).))))..(((((….)))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table