Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA103988 Similarity: 0.975 Similarity: 0.973 Similarity: 0.973
UTR: 5HSAA103988
Gene: SS18L2
MFE: -41.354
ENS: 0.984
Length: 117.
Predicted Ligands:
methionine - 5/20
molybdenum - 4/20
SAM - 3/20
 RS: URS0000C0D1BB_1641811
MFE: -47.204
Ligand: SAM
Species: Actinobacteria bacterium IMCC26207 SAM-I/IV variant riboswitch
 RS: URS0000D9ACFC_1797677
MFE: -34.315
Ligand: molybdenum
Species: Clostridiales bacterium GWB2_37_7 Moco (molybdenum cofactor) riboswitch
 RS: URS0000DAC07D_1121316
MFE: -22.279
Ligand: molybdenum
Species: Clostridium grantii DSM 8605 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA103988 URS0000C0D1BB_1641811 URS0000D9ACFC_1797677 URS0000DAC07D_1121316
Length 117. 117. 118. 116.
Similarity - 0.975 0.973 0.973
Ensemble Norm 0.984 - - -
MFE -41.354 -47.204 -34.315 -22.279
Ligands - SAM molybdenum molybdenum
Gene SS18L2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 5.007 9.004
Length SE - 0. 1. 1.
Lev Distance - 32. 33. 31.
UBS 11. 11. 10. 10.
BS 0. 0. 0. 0.
ILL 2. 1. 3. 1.
ILR 1. 2. 2. 2.
H 3. 3. 2. 2.
BL 5. 5. 5. 4.
BR 4. 5. 5. 6.
UN 0.051 0.017 0.136 0.112

Sequences

Field Description
UTR seq + 25 uaggcgggagcauccaaucaacuucgagagcguaggccccaccuaucgugggucgaguugcuuggcggucgugguuccggagguuccucgggATGTCGGTGGCCTTCGTACCGGACT
UTR dot + 25 …((….))..((((.((((.((((..(((((((…..)))).)))…)))))))).)))).((((.((((..((((((((.(.(((….)))).)))))))).))))))))
RS 1 seq ACUGAUCAUCAGGAGUGGCCCCUCGGGGUCCGGCAACCUGGGACGGACACCCAAGGUGCCUUCUCGCUUCGGCGAGGAUGUGGCAGACCGCGCAGGUUCGCAACCAAGUGUCCGAAG
RS 1 dot .((((…))))(((.(((.(((.((((((((………..))))).))).))).)))..))).((((((((.((.((((…((((…..)))))))).))…)).))))))
RS 2 seq AUAUACAAAAAUUUCCGAGCCGCAGCAUCUAAAGGCACUGCCCAUGAAGCUGCAGCCGAUGGGUAUGGAGAGAAAUUUCCUUGCCUCCCUGUUGGAAAGGAAAUGCUGUUUUGAUCUA
RS 2 dot ……………((.((.(((((.((….(((…)))…)).))))).)))).(((((..(((.((..((((((((.((……..)).)))))))).)).)))..)))))
RS 3 seq GUAAAUUAUUAGCUCUGAAUUAAAAAACCUAAGGGAAACUAUGGUCUUUUAAUCUGGGUGCUACUGGAAACGGUUGUGCCUCCCGUGUUUGGAAAGGAGAUAUAUUACAUGUUUUU
RS 3 dot ………((((.((.((((((((.(((..((…..))..))).))))))).).)).))))…((((((((((((.((((…………)))).))))..)).)))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table