Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA104180 Similarity: 0.987 Similarity: 0.986 Similarity: 0.984
UTR: 5HSAA104180
Gene: ST14
MFE: -10.358
ENS: 0.990
Length: 69.
Predicted Ligands:
fluoride - 16/20
SAM - 2/20
homocysteine - 1/20
 RS: URS0000D82817_1895926
MFE: -11.255
Ligand: fluoride
Species: Bacteroidetes bacterium 47-18 Fluoride riboswitch
 RS: URS00022FBC9A_219649
MFE: -16.721
Ligand: fluoride
Species: Paraburkholderia unamae Fluoride
 RS: URS0000C3146E_1198452
MFE: -15.833
Ligand: homocysteine
Species: Janthinobacterium sp. HH01 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA104180 URS0000D82817_1895926 URS00022FBC9A_219649 URS0000C3146E_1198452
Length 69. 68. 69. 69.
Similarity - 0.987 0.986 0.984
Ensemble Norm 0.990 - - -
MFE -10.358 -11.255 -16.721 -15.833
Ligands - fluoride fluoride homocysteine
Gene ST14 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14. 7.017 3.001
Length SE - 1. 0. 0.
Lev Distance - 12. 17. 21.
UBS 5. 3. 4. 6.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 1. 1.
H 2. 2. 2. 2.
BL 3. 0. 1. 3.
BR 2. 1. 1. 3.
UN 0.275 0.265 0.145 0.246

Sequences

Field Description
UTR seq + 25 agauaauaaggaagcaggaauaaggaaauggauuguaucaggaaATGGGGAGCGATCGGGCCCGCAAGG
UTR dot + 25 ……….((.((((……………)))).))……((.((.((……)))).))…
RS 1 seq GAUAAAAAAGGAAAUGGUGUGCUUCCUUACCCAACCGCUUUCCACAAGCUGAUGACGCCUGAUCAUUA
RS 1 dot ………(((((((((……………)))).)))))……((((……..))))…
RS 2 seq GAAGUUGCGGGAGAUGGCAUACCUCCUCAAACCGCCGGUUUUCGCCCGGCUGAUGAUGCCUACGGUUCC
RS 2 dot ……(((((((.((((……………)))).)))))))(((((…….)))…))….
RS 3 seq CCUUCCGAGGAGCGUUGCGACGAAUCACGAAUUCGCCAGGCUCGGAGUCCCAAACCGCGCUCACGUUAC
RS 3 dot ………((((.(.((((((…..))…)))).).)))).((((.(……).))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table