Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA104249 Similarity: 0.964 Similarity: 0.963 Similarity: 0.963
UTR: 5HSAA104249
Gene: ST6GAL2
MFE: -42.317
ENS: 0.878
Length: 144.
Predicted Ligands:
cobalamin - 10/20
FMN - 9/20
tetrahydrofolate - 1/20
 RS: URS0002327C7E_1895848
MFE: -54.805
Ligand: cobalamin
Species: Sphingomonas sp. 66-10 Cobalamin riboswitch
 RS: URS000231894A_161398
MFE: -28.274
Ligand: cobalamin
Species: Pseudoalteromonas phenolica Cobalamin riboswitch
 RS: URS0000AB7D61_261594
MFE: -39.781
Ligand: FMN
Species: Bacillus anthracis str. 'Ames Ancestor' FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA104249 URS0002327C7E_1895848 URS000231894A_161398 URS0000AB7D61_261594
Length 144. 145. 144. 144.
Similarity - 0.964 0.963 0.963
Ensemble Norm 0.878 - - -
MFE -42.317 -54.805 -28.274 -39.781
Ligands - cobalamin cobalamin FMN
Gene ST6GAL2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11. 11. 3.
Length SE - 1. 0. 0.
Lev Distance - 42. 44. 49.
UBS 11. 13. 10. 10.
BS 0. 0. 0. 0.
ILL 4. 5. 5. 4.
ILR 3. 4. 4. 3.
H 2. 2. 2. 1.
BL 4. 5. 2. 4.
BR 4. 6. 2. 3.
UN 0.056 0.034 0.076 0.042

Sequences

Field Description
UTR seq + 25 cagggggagcaccgagcaccacggugucgugcgcuucgaggcgcggcgugggaagaaggcugguucauucugccacccaucugcauuaagacacaaggugcugaccgcagagaccugccATGAAACCACACTTGAAGCAATGGA
UTR dot + 25 ..(.(.((.(((((…….))))))).).)((((((((…….((((……(((.((((…(((((((((..(((……)))…..))))……))))))))).)))……)))).))))))))……
RS 1 seq UUGACGCCGCGGCGCUGCGGCUUCUAGGUCGCGCCUGCACAGAGGAAGAAGAAGCCGGUGAAAGCCCGGCGCGGUCGCGCCACUGUAACCGACACUGCGAAGCGGGGUCGGGAGCCAGACCUUCUCCCUCGGGCGACAAACCUCU
RS 1 dot ..((.((((((….)))))).)).((((.((((((…..((((.(((((…..(((…..((((((.(.((..(((…(((…..)))..)))..)).).)))))).)))….))))).))))))))).)..))))..
RS 2 seq UUGUGUUUUAGACAUCUAGACUUCAUAAUAUGGUUUUUCUGAUUAAUCUUGGGAAUAAGCUGAAACUGCUUAACUGUCCCCGCAACUGUGAAGUGCAUUUAAAUGCACGAAGUCAGAUACCAAGGUCAGAAAAAUCCUCUUGAG
RS 2 dot (((((.(((((….)))))…)))))…((((((((((((….(((((..((…((((…(((((((.(((…(((….)))….))).))))..)))…..)))))).)))))))))))))))))……..
RS 3 seq AGCAUCCUUCGGGGUCGGGUGAAAUUCCCAACCGGCGGUGAUGAAGUGCAAACUUCUAAGUCCGUGACCCGUUUUCAACUCGAAAACGGUGGAUCUAGUGAAACUCUAGGGCCGACAGUAUAGUCUGGAUGGGAGAAGGAUAUG
RS 3 dot …(((((((……………(((((.((((((((..((.(((.((…..(((.(((((….((((((((…..))))))))))))).)))))..))).))..))))……….)))).))))))))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table