Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA104330 Similarity: 0.941 Similarity: 0.934 Similarity: 0.933
UTR: 5HSAA104330
Gene: STAB2
MFE: -45.778
ENS: 0.792
Length: 211.
Predicted Ligands:
cobalamin - 17/20
lysine - 1/20
glucosamine - 1/20
 RS: URS000232961A_655815
MFE: -45.103
Ligand: cobalamin
Species: Zunongwangia profunda SM-A87 Cobalamin riboswitch
 RS: URS0002332BB0_316056
MFE: -77.435
Ligand: cobalamin
Species: Rhodopseudomonas palustris BisB18 Cobalamin riboswitch
 RS: URS000231F747_1263073
MFE: -49.799
Ligand: cobalamin
Species: Dorea formicigenerans CAG:28 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA104330 URS000232961A_655815 URS0002332BB0_316056 URS000231F747_1263073
Length 211. 212. 212. 213.
Similarity - 0.941 0.934 0.933
Ensemble Norm 0.792 - - -
MFE -45.778 -45.103 -77.435 -49.799
Ligands - cobalamin cobalamin cobalamin
Gene STAB2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1. 14.003 11.
Length SE - 1. 1. 4.
Lev Distance - 78. 81. 79.
UBS 10. 10. 12. 12.
BS 0. 0. 0. 0.
ILL 3. 2. 2. 2.
ILR 2. 2. 4. 2.
H 6. 6. 6. 7.
BL 1. 1. 3. 3.
BR 0. 0. 1. 1.
UN 0.204 0.208 0.146 0.197

Sequences

Field Description
UTR seq + 25 gccauuuuuccuuucugaaggcaggucucaccuaucuccugguucgaucuaggaaaaaggaaaggaagggauuuaaaaguaaacagugaaaugagaaagaauucacugggaguuuaucaaacuaaguuaaaauagcuaagucagccugacaggugcuuggcacagagaaggagcaaauauuuccucATGATGCTACAACATTTAGTAATTT
UTR dot + 25 ….((((((((((((……(((((..(((……..)))..)))))……..))))))))))))………….(((((((………..)))))))..(((((…)))))………..(((((((..((((…)))))))))))…..(.(((((…….))))))….(((((…….)))))….
RS 1 seq AACAUUGUCUCGAUUUUCGGUUACUGUUCCUUGGGAUGGUAUUAAAAGGGAAUCAGGUGUAAACCCUGAACAGUUCCCGCUGCUGUAAAUUCUUUCCGGAUAAAAUGCCGGAAAAUCUUUCUAAAUUAUUAGUUGUAUUCCACUGUCAUAAGUGAUGGGAAGGAUUAGAAAGAGGAAUGAGUCAGAAGACCUGCCGAAAGUUUUAAAAACAA
RS 1 dot …((((((((((…..((……..))))))))))))…….((((((((((…….)))))….)))))…………..(((((((……..))))))).(((((((((…………..(((.((((((….))))))…))))))))))))…….(((….)))((……))…………
RS 2 seq UUGAUACGCAUCACCCGUGGUUCUCGCCCGGCGGUGCCGGACGAGAUAAUAGGGAACACGGUGCACCGCGUCCGCGCGGUUAUUCCGAGGCUGCCCCCGCAACUGUAAGCGGCGAAUCUCGCCGACGAACACCACUGGCCCGCAACGGCUGGGAAGGUUCGGCGAGAUGAUGACCCGUGAGCCAGGAGACCUGCCACACCCGUUCGCACCUG
RS 2 dot …….(((((.(((…..(((((.(((((…))))).)))))…..)))…..)))))((((((….))))))……..((….))((((……..))))…((((((((((…..(((.((((((……))))))…)))))))))))))……..((((((((((…))))……..))))))…..
RS 3 seq AGAAUAAAAAAUGUGUGAGGUGUCAGUCAGAGAAAGAUAUUAUAAAAAGUUAUUUAUCUGGCUGAUGAAAAGGGAAACAGGUGUGAAUCCUGUACGAACUCGUCACCGUAUUUUGCGAGCUUUGAAUCCUACAUGCCACUGGGAGACCGGGAAGGCUGAUUUUAGAGCGCCUGAGCAAUAAGCCGGGAUACCUGCCUUUCACAGUACAGGAAC
RS 3 dot …………………((((((((((…(((((………..))))).))))))))))……….(((((…….)))))(((….)))…((((…)))).((((((((…..((.(((.((((….))))…)))))..)))))))).((((.((…..))))))…((((…………))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table