Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA104331 Similarity: 0.989 Similarity: 0.988 Similarity: 0.988
UTR: 5HSAA104331
Gene: STAC
MFE: -19.306
ENS: 0.796
Length: 64.
Predicted Ligands:
fluoride - 19/20
unknown - 1/20

 RS: URS0000C2603C_1423792
MFE: -12.232
Ligand: fluoride
Species: Lactobacillus perolens DSM 12744 Fluoride riboswitch
 RS: URS0000D8EE66_146922
MFE: -22.184
Ligand: fluoride
Species: Streptomyces griseofuscus Fluoride riboswitch
 RS: URS0000D6B9EB_12908
MFE: -19.957
Ligand: unknown
Species: unclassified sequences nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA104331 URS0000C2603C_1423792 URS0000D8EE66_146922 URS0000D6B9EB_12908
Length 64. 65. 64. 64.
Similarity - 0.989 0.988 0.988
Ensemble Norm 0.796 - - -
MFE -19.306 -12.232 -22.184 -19.957
Ligands - fluoride fluoride unknown
Gene STAC - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.001 4.002 2.
Length SE - 1. 0. 0.
Lev Distance - 13. 15. 16.
UBS 4. 4. 4. 5.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 1.
ILR 1. 1. 2. 1.
H 2. 2. 2. 2.
BL 1. 1. 0. 1.
BR 1. 0. 0. 2.
UN 0.109 0.138 0.156 0.094

Sequences

Field Description
UTR seq + 25 guuccuccgggagcccaacaccguucccgcgcggccacgATGATCCCTCCGAGCAGCCCCCGCG
UTR dot + 25 …….(((((((……..)))))))(((((……((.((…..)).))….)))))
RS 1 seq CAUCUAAUCGGUGAUGACGUUCGCCGUAACCAUUACAGAACGUAAUUAAUGACGUCUACAGUUGC
RS 1 dot ………(((((……)))))(((((……((.((((……..))))))…)))))
RS 2 seq ACGGAGAUGGGCGAUGAGGCUCGCCCUUGAGCGCACGUUCCGUGCUGAUGGCCUCUGCGAGCAC
RS 2 dot ……..((((((……)))))).((..((((….((((….))))….))))..)).
RS 3 seq GGGUGCUGACUGCUUGGUGCAGUGAGGCAGGUUAAAAAGACUACGCUGGUCGGGCCGCCAUGCG
RS 3 dot …..((.(((((…..))))).))((((((……(((((…)))))…..))).))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table