Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA104362 Similarity: 0.939 Similarity: 0.938 Similarity: 0.937
UTR: 5HSAA104362
Gene: STAG2
MFE: -38.996
ENS: 0.743
Length: 199.
Predicted Ligands:
cobalamin - 14/20
glucosamine - 2/20
Mn2+ - 2/20
 RS: URS0000AB5D2B_1033810
MFE: -43.830
Ligand: glucosamine
Species: Haloplasma contractile SSD-17B glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000AB435A_349967
MFE: -73.120
Ligand: Mn2+
Species: Yersinia mollaretii ATCC 43969 yybP-ykoY manganese riboswitch
 RS: URS0002325CAE_1144311
MFE: -52.256
Ligand: cobalamin
Species: Brevibacillus sp. CF112 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA104362 URS0000AB5D2B_1033810 URS0000AB435A_349967 URS0002325CAE_1144311
Length 199. 198. 199. 197.
Similarity - 0.939 0.938 0.937
Ensemble Norm 0.743 - - -
MFE -38.996 -43.830 -73.120 -52.256
Ligands - glucosamine Mn2+ cobalamin
Gene STAG2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.007 10.035 4.001
Length SE - 1. 0. 4.
Lev Distance - 78. 78. 76.
UBS 11. 11. 13. 12.
BS 0. 0. 0. 0.
ILL 3. 4. 3. 4.
ILR 4. 4. 3. 4.
H 3. 3. 4. 4.
BL 4. 2. 4. 4.
BR 3. 2. 5. 2.
UN 0.266 0.182 0.080 0.228

Sequences

Field Description
UTR seq + 25 uccccucgacaccccacuaaagacagaagaaccgcggcucgaucggguccgcggcggaagcgcggccaaacgaaugagaauugucuuagaagaaagaaggcaagccaccauuuuacccacguaaauauaugaauauauuucugacauugagguguuccagaagaugauaaagaaATGATAGCAGCTCCAGAAATACCAA
UTR dot + 25 ………………………….(((((((((….))).))))))…..(((.((……(((((.(..(((((((………)))))))..)..)))))…)).)))………….((((((((…..(((.((((.((…………….))..)))).)))))))))))….
RS 1 seq UAUAAAAAUAAAGCGCCAGGACUACAUAUCUAAUAGAGUUAUUUUAAUGAUACAUGAAUAACUGAAAGUGUGAUUGUAGUUGACGAGGAGAAGGUUGAUCGAAUUUUCGGCGGAUGCCUUCUAGUGUUCAUCCAUACUAAAAGCUAUUUAACAAAACUGUUAGGAGACUAAUAGUACAAAAAAAUAGCAGGAUGUGGG
RS 1 dot ……………….(((((((.(((..((..((((((((………..))))))))….))..))))))))))…….(((((((((.((((….))))))…)))))))………(((((((….(((((((……((((((((….))))))))……))))))).)).))))).
RS 2 seq UGCGCCGUUCAUGGGGAGUAGCCGGUUUCUAUUCGUUCUAUUUUUAAUAGUGCGAUAAACAGAAACGCUCGUAUCAACAUACUCGUUUCAUCUAUUGAAACGUGGUGCGAGCAGCCAGGUAAGGUUGGCGAGACCAUAGACACGUAGCUCCGUCGUUAGGUUGGGGGUGGGUUACGUGUAUAUGGAGCCGCCCGGCCGA
RS 2 dot (((.((……..)).)))….((((((..((((.(((((…))))).))))…..))))))((((((((((…….(((((((…..)))))))))))))))))……….((((((((…(((((.((((((((((((.(((……))).))..)))))))))).)))))…)))).))))..
RS 3 seq UACAUAUUGAUGCGGACAGGUGUUUGCCACGCUAUAUUUGGUAGACUUAAUAGGGAAGUCGGUGAAAUUCCGACGCGGUCCCGCCACUGUGAUGAGAGAGUUCCAUUUGGUUUUUGCGCCACUGAUUAGCUGAUCGGGAAGGCACGAAUGGAGCGAUGACCCCGAGCCAGGAGACCUGCCUGACCGUCAGCACUGUG
RS 3 dot …………………((((((((………))))))))……((((.(((((…….)))))….))))……(((.((.(((((..((….))))))).)).)))……(((((.(((..(((((….(((..((…….))..)))…….)))))..))))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table