Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA105016 Similarity: 0.980 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA105016
Gene: STK11IP
MFE: -21.285
ENS: 0.683
Length: 68.
Predicted Ligands:
fluoride - 12/20
cobalamin - 4/20
guanine - 4/20
 RS: URS00023306F8_29313
MFE: -16.484
Ligand: fluoride
Species: Mycobacterium shimoidei Fluoride riboswitch
 RS: URS0000BECB54_755172
MFE: -9.009
Ligand: fluoride
Species: Peptoniphilus sp. RMA 16757 Fluoride riboswitch
 RS: URS00007F7335_190486
MFE: -15.157
Ligand: fluoride
Species: Xanthomonas axonopodis pv. citri str. 306 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA105016 URS00023306F8_29313 URS0000BECB54_755172 URS00007F7335_190486
Length 68. 67. 69. 68.
Similarity - 0.980 0.980 0.980
Ensemble Norm 0.683 - - -
MFE -21.285 -16.484 -9.009 -15.157
Ligands - fluoride fluoride fluoride
Gene STK11IP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.001 14.053 7.002
Length SE - 1. 1. 0.
Lev Distance - 23. 21. 25.
UBS 7. 7. 4. 7.
BS 0. 0. 0. 0.
ILL 2. 3. 1. 2.
ILR 2. 3. 2. 1.
H 3. 1. 1. 2.
BL 2. 2. 2. 3.
BR 1. 2. 1. 3.
UN 0.118 0.090 0.348 0.162

Sequences

Field Description
UTR seq + 25 gauaggcgccgggcagcugagcugguaggaggaccagacggggATGACGACCGCTCAGAGGGACTCCC
UTR dot + 25 …..((…..))..((((((.(((.(..(..((…..))..)..).))))))))).(((…)))
RS 1 seq ACUGUGAGCAGAAAUGGCAGUCUUCCGGGCAACCGCCGGUUUUCAGGCUGAUGAUGCCUUCGACUUC
RS 1 dot …..(((..(((..(((((((..((.((.((((…)))).)).))..)))..)))))))..))).
RS 2 seq AAGAAAAUAGGGAAUGAAGUUCUCCCUUGGGCAACCUAAACCGCAACAGCUGAUGACUUCUACGAUUUU
RS 2 dot ……………((((((.((..(((.((……….))..)))..)).))))))………
RS 3 seq GGCCGCACAGGAGAUGGCAUUCCUCCUCGAACCGCACGCACCCGCGCGCUGAUGAUGCCUGCCCACCC
RS 3 dot ..((…..))….((((..(.((.(((….((.(((….))).))))).)).)..))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table