Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA105031 Similarity: 0.990 Similarity: 0.990 Similarity: 0.990
UTR: 5HSAA105031
Gene: STK19
MFE: -6.313
ENS: 0.913
Length: 47.
Predicted Ligands:
unknown - 11/20
glutamine - 4/20
SAM - 2/20
 RS: URS0000E605CE_1798803
MFE: -10.370
Ligand: unknown
Species: Alkalibacterium sp. 20 DUF1646 RNA
 RS: URS0000E5FB25_1911586
MFE: -10.570
Ligand: unknown
Species: Marinilactibacillus sp. 15R DUF1646 RNA
 RS: URS0000E600B0_1255619
MFE: -6.770
Ligand: unknown
Species: Vagococcus fluvialis bH819 DUF1646 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA105031 URS0000E605CE_1798803 URS0000E5FB25_1911586 URS0000E600B0_1255619
Length 47. 47. 47. 46.
Similarity - 0.990 0.990 0.990
Ensemble Norm 0.913 - - -
MFE -6.313 -10.370 -10.570 -6.770
Ligands - unknown unknown unknown
Gene STK19 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0.007 0.007 0.005
Length SE - 0. 0. 1.
Lev Distance - 14. 14. 13.
UBS 2. 2. 2. 2.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 2. 2. 2. 2.
BL 0. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0.234 0.319 0.319 0.304

Sequences

Field Description
UTR seq + 25 cgguaccauaaaaucccgggauATGCAAAAGTGGTTTTCTGCTTTCG
UTR dot + 25 (((…………)))………(((((((….)))))))..
RS 1 seq GGUUGGGCGUUAGCUUUCAAGGAUUAUUUCUUCUGGGGUGAGAAGAA
RS 1 dot ….((((….))))………..(((((((……)))))))
RS 2 seq GGUUGGGCGUGAGCUUUCAAGGUAAAUAUCUUCUGGGGUGAGAAGAU
RS 2 dot ….((((….))))………..(((((((……)))))))
RS 3 seq GGUUGGGCGUAAGCUUUCAAGGUGUGUUUUUCUAGGGCGAGAAAAA
RS 3 dot ….((((….))))……….(((((((……)))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table