Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA105066 Similarity: 0.978 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA105066
Gene: STK31
MFE: -32.453
ENS: 0.692
Length: 92.
Predicted Ligands:
TPP - 8/20
zmp-ztp - 4/20
glycine - 3/20
RS: URS0000C872A7_77635
MFE: -23.
Ligand: TPP
Species: Bifidobacterium subtile TPP riboswitch (THI element)
RS: URS0002318797_33050
MFE: -32.882
Ligand: zmp-ztp
Species: Sphingopyxis macrogoltabida ZMP/ZTP riboswitch
RS: URS0000AB991D_525310
MFE: -21.033
Ligand: TPP
Species: Lactobacillus brevis subsp. gravesensis ATCC 27305 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA105066 URS0000C872A7_77635 URS0002318797_33050 URS0000AB991D_525310
Length 92. 92. 90. 91.
Similarity - 0.978 0.978 0.978
Ensemble Norm 0.692 - - -
MFE -32.453 -23. -32.882 -21.033
Ligands - TPP zmp-ztp TPP
Gene STK31 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.006 4.001 3.002
Length SE - 0. 4. 1.
Lev Distance - 25. 23. 27.
UBS 9. 9. 8. 9.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 1.
ILR 2. 2. 1. 1.
H 2. 2. 2. 2.
BL 4. 2. 3. 3.
BR 5. 3. 5. 4.
UN 0.033 0.109 0.067 0.077

Sequences

Field Description
UTR seq + 25 gcggucgaagcucacgcgguaagccgcugcacgugugcuacggcgggcggagggccgaaaguccaguATGTGGGTCCAGGGTCACTCTTCTA
UTR dot + 25 .(.((((.(((.((((((((…..)))))..))).))).)))).)(.((((((((…..((((…..))))…..)))).)))).)..
RS 1 seq CCCGAAGUGCCGGGGUGCCCGCAAGGGCUGAGAACACACCCGCAACACCUGAUCUAGACAGUGCUAGCGAAGGGAGCCAUAUGACUCAGGUC
RS 1 dot …….((.((((((((((….))))…….)).))))))..((((((((……(.(((..(….).))))….)).)))))).
RS 2 seq GCAGCGUCCCGCAACUGGCGCUGAUGAUGGAGCUCCAUCGGGAAGCGGGAUUGGUCGAAAGCCGGAGAGCCGCGCGCCUGGGUGAUCCGU
RS 2 dot …((.(((((….(((.(((……..))).))).))))).)).((((((.(((…(((((….))).))…))).))))))..
RS 3 seq AUUCGUGGUCUAGGGUGCCUUUAAUGGCUGAGAAAUACCCAUGGAACCUGCUGCAGUUAGUACUGUCGAAGGAAGAUCGAGUAAUUAGCAU
RS 3 dot ……(((((((((((((……)))……..)))).)))).))(((((..((((.(.(.(((…….))).)).))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table