Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA105097 Similarity: 0.965 Similarity: 0.965 Similarity: 0.963
UTR: 5HSAA105097
Gene: STK32B
MFE: -54.857
ENS: 0.807
Length: 137.
Predicted Ligands:
cobalamin - 7/20
FMN - 4/20
glycine - 3/20
 RS: URS0000BE1544_290398
MFE: -50.806
Ligand: fluoride
Species: Chromohalobacter salexigens DSM 3043 Fluoride riboswitch
 RS: URS0000C544CB_281362
MFE: -57.004
Ligand: cobalamin
Species: Dechloromonas denitrificans Cobalamin riboswitch
 RS: URS00023339DE_1933778
MFE: -50.766
Ligand: cobalamin
Species: Saccharothrix sp. ALI-22-I Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA105097 URS0000BE1544_290398 URS0000C544CB_281362 URS00023339DE_1933778
Length 137. 136. 136. 137.
Similarity - 0.965 0.965 0.963
Ensemble Norm 0.807 - - -
MFE -54.857 -50.806 -57.004 -50.766
Ligands - fluoride cobalamin cobalamin
Gene STK32B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.001 9. 7.003
Length SE - 1. 1. 0.
Lev Distance - 40. 41. 46.
UBS 13. 11. 13. 12.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 2.
ILR 4. 2. 4. 3.
H 3. 3. 2. 3.
BL 5. 4. 7. 6.
BR 5. 5. 7. 3.
UN 0.051 0.081 0.059 0.109

Sequences

Field Description
UTR seq + 25 guagccggcgaggagcgccgcacguuggccccggcgcgaggagcucccggguucccgggcgggcacuggaguaaggagcugcgagcgcagcccgaggcagcaacggcggaauATGTATGCAATGAAGTACATGAACA
UTR dot + 25 ((..((…..)).)).((((.((((((((.((((((..(.(((((((.(((.(((….))).))).)…..)))))).)..))))….)).)))..)))))))))..(((((((……..)))))))….
RS 1 seq GUGGAUGCCGGAGAUGGCAUUCCUCCGGUCGCCGAGCCCCGUCAUGUGCGGUGCCACCGCGACAAACCGCCUGGCGUGAUCCGAGACCAUGACGUCUCGACCACCGGCCGCCAGCGCUAAUGAUGCCUGCCAACGC
RS 1 dot ..((((((((….))))))))..(((((.(.((((…(((((((..((((((((..(((……))).)))))….)))….))))))).)))).).)))))..(.(((.((…….))))).)…..
RS 2 seq GGAACACGGUGCGAAUCCGUGGCGGGCCCGCCGCUGUAACCGGGGACGAAGGCUGCAUGGUCGCCAGACCAGCCACUUGCGGGGCAUACCCCGCCGGGAAGGCGCAGCGCUUCGGCUGAUCCGGAAGCCAGAAGAC
RS 2 dot ……((.((((..(.(.((((((((((((.((((…..((.(((.(.(….).).))).))….))))…..)))))……))))))).).)..)))).))((((((((……..)))).))))..
RS 3 seq UGUCGAUCGAAGUGCGACGAUGCCCAGGCUGUAGAGGGGGUGCGCGAGGAAGCCGGUGCGAAUCCGGCACGGUCCCGCCACUGUGACCGGGCCUUGGGAUCCGGGAGUCAGGAACUCGACCCCCGACUCAUCGACCG
RS 3 dot (((((.(((…..))))))))((((((((…(..(.((((.(((.(((.(((((…….)))))….)))))))))).)..)..))))).)))…((((.(((……..))).))))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table