Detected as a riboswitch by 9 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA105418 Similarity: 0.945 Similarity: 0.945 Similarity: 0.944
UTR: 5HSAA105418
Gene: STRN3
MFE: -27.492
ENS: 0.859
Length: 167.
Predicted Ligands:
Mg2+ - 6/20
TPP - 6/20
lysine - 5/20
 RS: URS0000AB6F14_256318
MFE: -47.564
Ligand: Mg2+
Species: metagenome sequence M-box riboswitch (ykoK leader)
 RS: URS0000AB9EB5_626522
MFE: -47.929
Ligand: TPP
Species: Prevotella tannerae ATCC 51259 TPP riboswitch (THI element)
 RS: URS0000C2D74B_5078
MFE: -53.244
Ligand: TPP
Species: Penicillium griseofulvum TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA105418 URS0000AB6F14_256318 URS0000AB9EB5_626522 URS0000C2D74B_5078
Length 167. 169. 167. 170.
Similarity - 0.945 0.945 0.944
Ensemble Norm 0.859 - - -
MFE -27.492 -47.564 -47.929 -53.244
Ligands - Mg2+ TPP TPP
Gene STRN3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 23. 11. 5.016
Length SE - 4. 0. 9.
Lev Distance - 59. 70. 61.
UBS 9. 12. 11. 9.
BS 0. 0. 0. 0.
ILL 2. 4. 3. 1.
ILR 2. 4. 4. 3.
H 2. 3. 2. 1.
BL 2. 3. 3. 3.
BR 3. 5. 4. 2.
UN 0.192 0.189 0.198 0.065

Sequences

Field Description
UTR seq + 25 uccauuuuucaguuuccuauguaugguuaagggaaaauguaaauaaaugcaucuuuuauauuuuuaggcccggauugcauuucuacaaggcgaaagaaaaggucaagagaaccugaagaaggacuuaguaagaagaauaaagATGGACGAGCTTGCCGGAGGCGGTG
UTR dot + 25 (((.((((((((.((((((((((..(((..(((((((((((((………..))))))))))….))).))))))))…………………….)).))).)))))))))))………………………….((((….)))).
RS 1 seq AAUAAAGCUUGUUAGGUGAGGUUACUGGUUGAACAGAGGCUGCUGCCCGGAAAUGUCGAAAGACACCAAUGGGUAGAGCAGGCGUAGUCGGAUUAAGGCUUCGCAUAAGGCAGCUUUCCGGAAUCCGGAAUAAGUCAACCUGAACUAAAACUCUACGAGGAGCUUCAUG
RS 1 dot …(((((((.(((.((((((((..(((((..((…(.((((((((((….((((….))))….)))))..))))).)…))..))))).)))))))).))).).))))))((((…))))………………….((((….))))…….
RS 2 seq AUAAUAAUUUAGGGGUGCCUACUCGUGCCUUGCGGACGCUUUGCGCCGUGAGCUAUUCGGUUGAAGCAGUGAGCUGACGAACACGAGCUCCGCGGGGAGCGGCUGAGAACAAACCCUUAUAACCUGAUCCGGGUAAUGCCGGCGAAGAGAAAAUUACUGUUAUAUGC
RS 2 dot ………(((((((…..(((((.(((((((((.((((…..(((.((((((((…….).))).)))).)))…..))))))))))))).))….)))…..)))))))….((…((((……))))…))………………..
RS 3 seq CCCACGCAUGACAGGUGUUCGGUCCAGUCAGUUGAUGGGGAGAAACUAUAAACCUAUCCAAUCUAGGAUUCAAGUGUUUCUUCUUCCCACAACUGGCUGGCUGAUCUGAGAUUAUACUGUCAAAACUUGAUCUAGACAAUACUAGCGAAAGGACAUGCGUGACUUUGAUU
RS 3 dot ..(((((((((((.((((((((.(((((((((((.(((((((((…..((((((((((……))))…)).)))).))))))))))))))))))))))))………)))))))))……………………………))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table