Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA105596 Similarity: 0.976 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA105596
Gene: STX18
MFE: -49.306
ENS: 0.696
Length: 109.
Predicted Ligands:
TPP - 14/20
guanidine - 4/20
SAM - 2/20
RS: URS0000C28C3D_926562
MFE: -28.457
Ligand: TPP
Species: Owenweeksia hongkongensis DSM 17368 TPP riboswitch (THI element)
RS: URS0000D938AE_1905845
MFE: -31.435
Ligand: TPP
Species: Methylomonas sp. LWB TPP riboswitch (THI element)
RS: URS0000C7AAF9_1538553
MFE: -33.440
Ligand: TPP
Species: Methylomonas denitrificans TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA105596 URS0000C28C3D_926562 URS0000D938AE_1905845 URS0000C7AAF9_1538553
Length 109. 108. 109. 108.
Similarity - 0.976 0.976 0.976
Ensemble Norm 0.696 - - -
MFE -49.306 -28.457 -31.435 -33.440
Ligands - TPP TPP TPP
Gene STX18 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.004 3.005 2.001
Length SE - 1. 0. 1.
Lev Distance - 30. 31. 31.
UBS 7. 6. 6. 7.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 1.
ILR 2. 2. 2. 3.
H 3. 3. 3. 3.
BL 1. 1. 0. 1.
BR 1. 1. 0. 1.
UN 0.046 0.111 0.119 0.083

Sequences

Field Description
UTR seq + 25 aguccuucagcggccggguucgcgccgcggucgccggcugcuuacgugggcgggccuaguguggggcugagggugcgggucgcuATGGCGGTGGACATCACGCTGCTAT
UTR dot + 25 …((((((((..((((((((((.(((((…((…..))…)))))))))))))…..)).)))))))).(((…))).(((((((((…….)))))))))
RS 1 seq UUGCCGCAAAUGGGGUGCUCCAAUUUUUGGGGCUGAGAUGAUACCCGGGAACUUUGUUCCGCACCUGAUCCAGAUAAUGCUGGCGUAGGGAUUUUAAGGUUUUUACAA
RS 1 dot ………((.((((((..(((((((((((…………))))))))..)))….)))))).))((((……)))).(((((((((….)))))))))..
RS 2 seq CUGAAAGGCUAGGGGUGCUUUCCGUCGAAACUUUAAUCCGGAAAGCUGAGAAAAACCCUUCGAACCUGAACCGGUUAAUGCCGGCGUAGGAAAGCCCAAAUCUUUUCCC
RS 2 dot …..(((..((((((((((((((..((……..))))))))))……..))))))….)))…(((((….)))))….((((((……..)))))).
RS 3 seq CUGAAAGGCUAGGGGUGCUUUCCGCUGUAUGCAAGCCCGGAAAGCUGAGAAAAACCCUUCGAACCUGAACCGGUUAACACCGGCGUAGGAAAGCCCUAUCUUCCCUGC
RS 3 dot …..(((..((((((((((((((((…….)))..)))))))……..))))))….)))…(((((….))))).(((((.(((……))).)))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table