Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA105625 Similarity: 0.878 Similarity: 0.873 Similarity: 0.873
UTR: 5HSAA105625
Gene: STX4
MFE: -116.612
ENS: 0.845
Length: 300.
Predicted Ligands:
cobalamin - 20/20 - 20/20


 RS: URS000231F071_1802656
MFE: -138.120
Ligand: cobalamin
Species: Xanthomonadales bacterium RIFOXYA1_FULL_69_10 Cobalamin riboswitch
 RS: URS0002332D95_326476
MFE: -120.404
Ligand: cobalamin
Species: Burkholderia sp. LMG 22940 Cobalamin riboswitch
 RS: URS000232CA75_1141663
MFE: -71.077
Ligand: cobalamin
Species: Providencia rettgeri Dmel1 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA105625 URS000231F071_1802656 URS0002332D95_326476 URS000232CA75_1141663
Length 300. 301. 301. 299.
Similarity - 0.878 0.873 0.873
Ensemble Norm 0.845 - - -
MFE -116.612 -138.120 -120.404 -71.077
Ligands - cobalamin cobalamin cobalamin
Gene STX4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 43.006 51.005 58.003
Length SE - 1. 1. 1.
Lev Distance - 128. 128. 123.
UBS 16. 19. 17. 18.
BS 4. 0. 8. 6.
ILL 1. 4. 6. 7.
ILR 4. 4. 6. 5.
H 6. 6. 4. 3.
BL 8. 5. 8. 6.
BR 7. 7. 6. 7.
UN 0.053 0.130 0.123 0.107

Sequences

Field Description
UTR seq + 25 gcgucgcucggucguuggggugccggggacgucgugaugagaacggcgucccagagacggcggugacagagccgggacacgugacagucacagggucacauucugcgguccacgaguuugggaccgggcuggucacgugacgcgauuuccguuggaagaugcaacgguuccggugacgguagcaaguucucgcguccaggcaucuccgcuuccgcucggggcgcaacaacuuccgacuccaccuucccagccucgggcaaggaagagacgcgaccATGGGGATGACAGCTCGGACGAAGA
UTR dot + 25 …..((((.(((…..(.(((((((((((((((…….))))))))))…..))))).)))).))))((.(.((((((((((((.((((((…))))))((((((.((….))))))))))))).))))))).).))….((((((…….))))))…(((.(((……..))).)))(((((.((((((((((((((((((((((((………………………)))))))))..)))))………..)))))))….))).)))))….
RS 1 seq GAUAUGUUGUGCCCUGUCGGUGCCGGCCUCGCGGUCGGAUGAAAAGGGAAGCCGGUCCAGGCCAUGGGUGAACCACCCCGGCCGACUCCGGCGCUGCCCCGCAGCGGUAGUGGAAACGAAAGCCGUCAUGGCACUGGGGCGAAUGCCCUGGGAAGCGACGGCCGGUAGGUGAGGCCAGUUCCUUUUAGGAGCGACGUAAGUCGCGAUCGGAUGCGAGAAGCAUCGCGACUUACGUCGCUCCUACAAAGGCAUCGAGUCCCGUGUCCAGAGCCCGAAGACCUGCCGACAGCCGCGCGAAGCA
RS 1 dot ………..((((.(((…((((((….)))))).)))..))))…((((….((((..(((((…))))).))))….))))((((((…))))))……………(((…..))).(((((((….)))))))…(((.(((((((((((((.((((.((.((((((((((((((((((((((((((…..(((…..)))))))))))))))))))))))).))))).)).).))).)……………..))))))))…)))))))……
RS 2 seq AGACUUGCUCGCAAUUCUGGUGCUCGCGCGCGUUGGUCUUUCGCGCGCGGUUAAACGGGAAGCAGGAAGCGGCCGAUCCGCCACGGACGAACCGCCAACCUGCGCUGCCCCCGCAACGGUAAGCGAAAGCCGCGCGUCAUGCUUCAUGCGUAGAUCGCAUGAUUCACGCGCGGCAGAGCCGGCUUCGGUGCAUGUGCGAUGGUCGUGCACACGCAUUGCUCCACUGCGCAACGCAUCACGCGCGGGAAGGUGAAGCGGCGUUUUCGUCAGCCCGGAUACCGGCCAGAAAAUCGAACGGAUC
RS 2 dot …(((.((.((..((((.((((.((((((((………))))))))))…)).)))))))).))).((((((((((…..((((((.((((…((.((((..((((((…(((..((….(((((((((…(..(((((((…..)))))))..))))))))))…))..)))..(((((.((((((.(((..((((….))))….))).))))))..)))))..))).)))..)))).)).))))..))))))….)))))..)))))…..(((…..))).
RS 3 seq ACUUACGAUAAUGGCUGUGGUUUAGGGAACUUGGUGUAAGUCCAAGACUGACGCGCAACGGUAAUUAAGGUAUCCCCGUCAUUCUUCAAGCUACAUGGGUGUUGGCAUCGCUCAGCUACCCUAGUCACAUACUUCAGUAUGCUCCUAGGGAUAUCUUCGCUUGCCGCCUACAUGUCACUUGAAUUAUUUAGGGGAUAUAACAGGUCGAAUUUUCAUUUUAUAUAUCGUUUUUAUUUCAUAUAUAGAAACCCAACUUGUUACUUUAUAAGUCCGAUACCUGCCACGCUACCAAUCGCUUU
RS 3 dot …..((((..((((.(((((..(((….(((((((.((((…)))).)))).)))(((….((((((((((((…….((((((..(((((((.(.(((((..((..((.((((((((…(((((….)))))…)))))).)).))..)).)))))))).)))))..))))))…….)))))))((((((((…..((((….(((((((.(……..).)))))))))))….)))))))))))))…..)))…))))))))))))…))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table