Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA105732 Similarity: 0.974 Similarity: 0.974 Similarity: 0.973
UTR: 5HSAA105732
Gene: STYXL1
MFE: -31.588
ENS: 0.948
Length: 101.
Predicted Ligands:
glycine - 8/20
Mn2+ - 4/20
SAM - 3/20
 RS: URS0000D9C016_1805219
MFE: -43.303
Ligand: TPP
Species: Ignavibacteria bacterium 13_1_40CM_2_61_4 TPP riboswitch (THI element)
 RS: URS000232BBEC_1940822
MFE: -24.922
Ligand: glycine
Species: Oceanospirillales bacterium LUC14_002_19_P2 Glycine riboswitch
 RS: URS0000C40C6D_1455
MFE: -30.268
Ligand: Mn2+
Species: Bacillus badius yybP-ykoY manganese riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA105732 URS0000D9C016_1805219 URS000232BBEC_1940822 URS0000C40C6D_1455
Length 101. 101. 99. 102.
Similarity - 0.974 0.974 0.973
Ensemble Norm 0.948 - - -
MFE -31.588 -43.303 -24.922 -30.268
Ligands - TPP glycine Mn2+
Gene STYXL1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.004 7.001 16.
Length SE - 0. 4. 1.
Lev Distance - 34. 28. 30.
UBS 4. 5. 5. 6.
BS 3. 2. 2. 0.
ILL 0. 0. 0. 1.
ILR 1. 1. 1. 0.
H 3. 3. 3. 3.
BL 2. 2. 1. 1.
BR 2. 1. 0. 2.
UN 0.109 0.050 0.131 0.127

Sequences

Field Description
UTR seq + 25 cucaggcaggacaaggagcugccuaacaagagguggaagggguuacguacguugcgaaagacuccaacccuccuggATGCCTGGTTTGCTTTTATGTGAAC
UTR dot + 25 ..((((((…(.(((((((((((……))))))..((((((.((((…))))…))))))….))))).).))))))((((((……))))))
RS 1 seq GACCGGUGACAGGGGUGCCCGCAGGCCGACUGCGGGCUGAGAUCACACCCUUUGAACCUGAUCCGGUUCGCACCGGCGAAGGGAGUUCCGUAUGAGCUGCC
RS 1 dot (.((((((..((((((((((((((…..))))))))………))))))((((((……)))))))))))))…((.(((((…..))))).))
RS 2 seq AUGAAGGUAGCAGGAGAGCGGUGAGUGGUUAUUCAGAGCCAUCACCCACCGAAGAAGUAAAUCUUUCAGGUGUCUCCCCCGACGAACAGCCCUUGUUGU
RS 2 dot …..((…..(((((..(((((.(((((……))))))))))(((((((((……)))))..)))))))))))((((((…….)))))).
RS 3 seq ACUUAAGUCAAAGGGGAGUAGCGUUAGGUAUUUUACCUAAAACAAAGUCGUCAAUUCAUGGACCACGUCCAUCGGCUUUGUUGGCAUGAGUGAAAGCAUGUC
RS 3 dot ………..(((((((((.(….).)))))).)))..((((((((((…….((((((…))))))))))))))))((((((……..))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table