Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA105736 Similarity: 0.982 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA105736
Gene: SUB1
MFE: -16.884
ENS: 1.
Length: 81.
Predicted Ligands:
SAM - 7/20
zmp-ztp - 5/20
cyclic-di-GMP - 2/20
 RS: URS0000D84B4C_29367
MFE: -11.968
Ligand: cyclic-di-GMP
Species: Clostridium puniceum Cyclic di-GMP-II riboswitch
 RS: URS0000BECBDA_123899
MFE: -21.819
Ligand: SAM
Species: Bordetella trematum SAM riboswitch (alpha-proteobacteria)
 RS: URS0000C853B8_1268237
MFE: -22.462
Ligand: glycine
Species: Aeromonas diversa CDC 2478-85 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA105736 URS0000D84B4C_29367 URS0000BECBDA_123899 URS0000C853B8_1268237
Length 81. 83. 81. 80.
Similarity - 0.982 0.982 0.982
Ensemble Norm 1. - - -
MFE -16.884 -11.968 -21.819 -22.462
Ligands - cyclic-di-GMP SAM glycine
Gene SUB1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.002 1.004 4.002
Length SE - 4. 0. 1.
Lev Distance - 18. 24. 22.
UBS 5. 5. 5. 6.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 3.
ILR 3. 2. 2. 2.
H 2. 2. 2. 2.
BL 0. 1. 0. 1.
BR 0. 1. 0. 1.
UN 0.235 0.277 0.296 0.275

Sequences

Field Description
UTR seq + 25 gucagucgcgagcgaacgaccaagaggguguucgacugcuagagccgagcgaagcgATGCCTAAATCAAAGGAACTTGTTT
UTR dot + 25 …….(((..(((((..((….))..)))))..)))…………((((((..(((…….)))…))))))
RS 1 seq UAAAAAGUUGGAAACGAGGAUGGAUUCUUUUAUUUGGGCACCUUAAGAAUUCGGAGUUAGUGGUGCAACCUGCCAGCAAUUAA
RS 1 dot ……(((.(((..(((((…..)))))..))).)))……………((((..((((…….))))..))))..
RS 2 seq UUCAUUGUCGGCGCCGAUUUGCCUGAUCCGCUUGCGGGCGCCCCUUAUAAAUCCCGCUAAAGAGGUCUGGAUGACCAGCUC
RS 2 dot ………((((((..(..((…….))..)..))))))………….(((…..((((…..)))))))..
RS 3 seq AUGAAGGUGGCAGGAGAGCGAUGGGUAACCAUCCACCGAAGAAGUAAAUCUUUCAGGUACCGGGUAACCGGUGUGGACUG
RS 3 dot …..(((((..((..(.(….).)..))..)))))…………..((((..((((((….))))))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table