Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA105939 Similarity: 0.988 Similarity: 0.986 Similarity: 0.985
UTR: 5HSAA105939
Gene: SUMF1
MFE: -25.423
ENS: 0.925
Length: 62.
Predicted Ligands:
fluoride - 10/20
glutamine - 4/20
unknown - 4/20
 RS: URS00008FED37_32046
MFE: -21.917
Ligand: glutamine
Species: L-glutamine riboswitch (58-MER) from Synechococcus elongatus (PDB 5DDO, chain B)
 RS: URS0000DA4003_1121425
MFE: -18.535
Ligand: fluoride
Species: Desulfotomaculum australicum DSM 11792 Fluoride riboswitch
 RS: URS0000C0A480_1302241
MFE: -17.991
Ligand: cobalamin
Species: Propionibacterium acnes JCM 18909 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA105939 URS00008FED37_32046 URS0000DA4003_1121425 URS0000C0A480_1302241
Length 62. 61. 62. 61.
Similarity - 0.988 0.986 0.985
Ensemble Norm 0.925 - - -
MFE -25.423 -21.917 -18.535 -17.991
Ligands - glutamine fluoride cobalamin
Gene SUMF1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.053 5.002 4.001
Length SE - 1. 0. 1.
Lev Distance - 13. 17. 18.
UBS 5. 3. 5. 6.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 1.
ILR 1. 0. 1. 1.
H 2. 2. 3. 2.
BL 2. 1. 0. 3.
BR 1. 1. 1. 2.
UN 0.048 0.279 0.097 0.082

Sequences

Field Description
UTR seq + 25 cacgugaccaaccgggucacauggcccgcgggacaacATGGCTGCGCCCGCACTAGGGCTGG
UTR dot + 25 ((.((((((…..)))))).))(((((((((.(………..))))))….))))…
RS 1 seq CGUUGGCCCAGGAAACUGGGUGGAAGUAAGGUCCAUUGCACUCCGGGCCUGAAGCAACGCU
RS 1 dot ..((.((((((….)))))).))….((((((……….))))))………..
RS 2 seq CUGCUCCAUGGCGAUGGAGCUCGCCUGGAAUGCCCGGAAAGGCUGAUGGCUCCUACCAAAAU
RS 2 dot ..(((((((….)))))))((((((((…..))….)))).))(((……)))….
RS 3 seq UCCGGUGAGAUUCCGGAGCGGUCCCGCCACUGUGAGACACCCCCCAUGCGGUGCAGCCAGA
RS 3 dot (((((…….)))))..(((..((((.(.(((.(……).)))).))))..)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table