Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA105943 Similarity: 0.952 Similarity: 0.946 Similarity: 0.943
UTR: 5HSAA105943
Gene: SUMO1
MFE: -59.009
ENS: 0.692
Length: 173.
Predicted Ligands:
cobalamin - 6/20
FMN - 4/20
Mg2+ - 4/20
 RS: URS0000DA2FB1_1502764
MFE: -60.826
Ligand: SAM
Species: Paenibacillus sp. UNCCL117 SAM riboswitch (S box leader)
 RS: URS0000D821D0_1038921
MFE: -64.650
Ligand: FMN
Species: Pseudomonas chlororaphis subsp. aureofaciens 30-84 FMN riboswitch (RFN element)
 RS: URS0000C69687_47763
MFE: -58.143
Ligand: TPP
Species: Streptomyces lydicus TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA105943 URS0000DA2FB1_1502764 URS0000D821D0_1038921 URS0000C69687_47763
Length 173. 174. 172. 174.
Similarity - 0.952 0.946 0.943
Ensemble Norm 0.692 - - -
MFE -59.009 -60.826 -64.650 -58.143
Ligands - SAM FMN TPP
Gene SUMO1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.005 16.001 16.001
Length SE - 1. 1. 1.
Lev Distance - 60. 61. 65.
UBS 17. 15. 15. 15.
BS 0. 0. 1. 0.
ILL 2. 2. 3. 3.
ILR 6. 5. 3. 5.
H 3. 3. 3. 4.
BL 8. 8. 8. 8.
BR 7. 6. 6. 4.
UN 0.023 0.092 0.058 0.057

Sequences

Field Description
UTR seq + 25 gcggaagugacgcgaggcguagcggaaguuacugcagccgcgguguugugcuguggggaagggagaaggauuuguaaaccccggagcgagguucugcuuacccgaggccgcugcugugcggagacccccgggugaagccaccgucaucATGTCTGACCAGGATAGCAGTGAGA
UTR dot + 25 ((((((.(..(((……..)))..).)).)))).(((.(((.((.(((((.(((((.(.(((……))).)…))))).)))……..))..))))).)))(((((((((.(((((((…..((((….))))……..))))..)).).)))))))))…
RS 1 seq CUCUUAUCAAGAGCAGGUUGAGGGACUAGCCCGAUGAUACCCGGCAACCGACACAAGAUGGCGUUAGCUCACCCCUCGCGGUGAUGCGGCGGCUGCCAGCUUGUGCACGGUGCUAAUUCUUGCGGAGCCUUUUACUGGGGAGCUUCUCCAGGCAAAGAUUCUGACAGAUGAGAG
RS 1 dot ….(((((.(.((.((((….)))).)).)..)))))…(((.((((.((((((.(((((((.(((((((……))))).))…))).)))).))))))..)))))))…(((..(((((.((((..(((((((…)))))))..)))).)))))..)))……
RS 2 seq CAACGUUCUCAGGGCGGGGUGUAAUUCCCCACCGGCGGUGAUUGCGCGCAAUGCGCAUAGCCCGCGAGCGCUUGGCGACAGGCACCGCUUCGGCGGCCAAUGACGGCAAGGUCAGCAGACCCGGUGUGAUCCCGGGGCCGACGGUCAUAGUCCGGAUGAAGAGAGAACGGGA
RS 2 dot …(((((((..((.((((…….)))).))..(((((..(((((.(((.((((………..)))))))))).))..)))))(((((.(((.(.(((((.(…(((…….(((((.(….)))))))))..).))))).).)))..))))).)))))))…
RS 3 seq CGGGGCGAGCGAGGGAGUUCGUAUCGAAGUGGCCUCAGGUUCAGAGAGCCCUGGUUCUCGCUGAGGACGUGAACGACGGUCGGACUGAGAGGCUGAAAGGUCGGAAGACCGGACGGCGACCCCCAAGCACCUGAUCCGGACAAUGCCGGCGAAGGGAGCCCACCUCGUAGGUCG
RS 3 dot (((.((((((……)))))).)))….((((((.(((((…((.((.(.((((.((…….)).)))).).)))))))))..))))))….((((….)))).(((.((((…….((.(((…((((……))))…)))..))…..))))..))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table