Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA105997 Similarity: 0.968 Similarity: 0.968 Similarity: 0.966
UTR: 5HSAA105997
Gene: SUPT5H
MFE: -40.106
ENS: 0.859
Length: 129.
Predicted Ligands:
cobalamin - 15/20
FMN - 4/20
glycine - 1/20
 RS: URS0000AB342B_12908
MFE: -31.378
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000DB0389_1797641
MFE: -45.425
Ligand: FMN
Species: Chloroflexi bacterium RBG_16_48_8 FMN riboswitch (RFN element)
 RS: URS0000DA82CB_1895795
MFE: -52.398
Ligand: cobalamin
Species: Myxococcales bacterium 68-20 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA105997 URS0000AB342B_12908 URS0000DB0389_1797641 URS0000DA82CB_1895795
Length 129. 131. 130. 129.
Similarity - 0.968 0.968 0.966
Ensemble Norm 0.859 - - -
MFE -40.106 -31.378 -45.425 -52.398
Ligands - cobalamin FMN cobalamin
Gene SUPT5H - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13. 8. 9.002
Length SE - 4. 1. 0.
Lev Distance - 31. 38. 41.
UBS 12. 10. 13. 12.
BS 0. 0. 1. 0.
ILL 3. 3. 2. 3.
ILR 2. 3. 2. 4.
H 3. 3. 2. 3.
BL 6. 4. 6. 5.
BR 5. 3. 7. 3.
UN 0.078 0.092 0.062 0.116

Sequences

Field Description
UTR seq + 25 aacggguagguucucgcgagaggacccgucagccccagucaggcgucgugcgaacagcagcugguaccgaaggcggagguggagcccgagagcagcagcggaagATGTCGGACAGCGAGGACAGCAACT
UTR dot + 25 …((((.(((((((….)))))))…..))))..(((.((((((.(.(…..((.((((.(..((..(((………)))))..).)))).))).).)))))).))).((…….))….
RS 1 seq UAACUGAAAUGCAUGGUGGGAAAUCAGUGUGAAAUUCAUUGGCUCUUCCUGGAACCGUAAAGUCGGAGCGCCACCCAGUUAAGCCCUUUGCUGAACGAAGGCCAGGAAAAGUCUAGUUCUAUAAUGAAAAA
RS 1 dot ….((((…((((.(((….))).))))…))))..((((.(((((((…(((..((.(((((.((………..)).)))))))..)))….))))))).))))…(((……)))…
RS 2 seq AUCAGCCUUCGGGGCAGGGUGAGGAGAUCGCUCCAACUCCCGACCGGCGGUAAAGCCCGCGAGCGCGAGUUGCGCAUGAUCUGGUGGAACUCCAGGGCCGACGGUACAGUCCGGAUGGUAGAAGGCUUUC
RS 2 dot …(((((((.(((..((((((…..)))).))..)))(((.(((((.(((….(((((.((.((((((.(((……..))).)))))..).)))).)))))).).)))).)))..)))))))…
RS 3 seq GGGAAGUCGGUCCAAUGCCGACGCGGUGCCGCCGCUGUAGCCGGGGACUCUCCUGGACCAUGCCACUCCGAUCGCAAGACGCGGCGGGAGGGGAGCUCCAAGAGGGAACGAUCCGGGAGCCAGAAGACC
RS 3 dot …..((((((…..))))))(((((…))))).((..(((((..(((((.((((.(.(.((.((((..((((…..))))..)))))).)).)))).)))))..)…))))..))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table