Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA106006-0 Similarity: 0.969 Similarity: 0.969 Similarity: 0.967
UTR: 5HSAA106006-0
Gene: SUPT5H_0
MFE: -36.906
ENS: 0.916
Length: 126.
Predicted Ligands:
cobalamin - 10/20
TPP - 3/20
glycine - 2/20
 RS: URS0000C23E2C_1449350
MFE: -45.229
Ligand: SAM
Species: Roseivivax halodurans JCM 10272 SAM-I/IV variant riboswitch
 RS: URS0000C193A6_1519495
MFE: -53.993
Ligand: cobalamin
Species: Streptomyces sp. NRRL F-6491 Cobalamin riboswitch
 RS: URS0000C785D3_1739114
MFE: -53.616
Ligand: glycine
Species: Novosphingobium sp. Fuku2-ISO-50 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA106006-0 URS0000C23E2C_1449350 URS0000C193A6_1519495 URS0000C785D3_1739114
Length 126. 124. 126. 125.
Similarity - 0.969 0.969 0.967
Ensemble Norm 0.916 - - -
MFE -36.906 -45.229 -53.993 -53.616
Ligands - SAM cobalamin glycine
Gene SUPT5H - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 6.001 4.
Length SE - 4. 0. 1.
Lev Distance - 34. 39. 41.
UBS 11. 10. 11. 11.
BS 0. 0. 0. 0.
ILL 3. 3. 1. 3.
ILR 2. 2. 3. 3.
H 3. 2. 3. 2.
BL 5. 4. 5. 6.
BR 4. 5. 3. 3.
UN 0.079 0.065 0.111 0.088

Sequences

Field Description
UTR seq + 25 aacggguagguucucgcgagaggacccgucagccccagucaggcgucgugcgaacagcagcugguaccgaaggcggagguggagcccgagagcagcggaagATGTCGGACAGCGAGGACAGCAACT
UTR dot + 25 …((((.(((((((….)))))))…..))))..(((.((((((.(.(……..((((.(..((..(((………)))))..).))))).).)))))).))).((…….))….
RS 1 seq UUUGGGCAUCAAGAGAGGACGUGUCCUCGCCAACCUGCCGACCCGGCGAAGGUGGCUCCCUCCCCGGAGGAGAUGCGGGCAAGAAGGCCGCACCCCCAUUCGGCCGCCAACAAUCGGGUUCAUU
RS 1 dot ….((((….(.(((((….))))).)…..))))(((((((….((((((……..((((((.(.(((((.(…..).))))).).)).))))))))))…..)))))))….
RS 2 seq GGGGAAUCCGGUGGAAGACCGGAACUGACGCGCAGCGGUGAGGGCGACGGGCGGAGCAUCGGCCACUGGGCGGCGACGACGGCCCGGGAAGGCGCCCCGUCCGGCCGACCCCGAGUCCGAAGACCU
RS 2 dot ……((((((…..)))))).(((…..)))(((((.(((((.(((((((.((….(((.((((((.(……).))))))…))))).)))))))..)).)))))…)))…….
RS 3 seq CAGUGAUGCUCUGGAAAGCGCACCGACCCUUUGGGCUGGUGCCACCGAAGGGGUAACCCCGCUGCACCGCCGAUAUCGGUGGCGCCUCGGGGAAAACUCUCAGGUUCCGCGACAGAGGGGGCUCC
RS 3 dot ..(((.((((……)))))))…(((((((.((.((.(((…(.((((….(((((..((.((((((….)))))).))..)))))….))))).))).))))..)))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table